Select all CORRECT answer choices regarding the following question: "Which of the following are means by which bacteria bring food into their cells?" Active transport Passive diffusion PTS Facilitated diffusion

Select all CORRECT answer choices regarding the following question: "Which of the following are means by which bacteria bring food into their cells?" Active transport Passive diffusion PTS Facilitated diffusion

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter3: The Plasma Membrane And Membrane Potential

Section: Chapter Questions

Problem 6RE

See similar textbooks

Related questions

Q: Punctate, errose, lobate, dry, convex, swarming, yellow, and circular are all terms that describe:…

A: Anabolism is a part of metabolism in which simple substances are formed from complex substances.…

Q: Birds undergo prolonged migratory flights, with some birds flying constantly for hours to days at a…

A: The phenomenon of migration can be described as the regular movement of individuals or groups of…

Q: It is possible to treat addiction by prescribing drugs that block the effects of the psychoactive…

A: Psychoactive compounds are chemicals that change brain function by influencing perception, mood,…

Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…

A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…

Q: abel the diagram by dragging the labels to the appropriate targets. DNA's secondary hydrophobic…

A: DNA or deoxyribonucleic acid contains the hereditary units called "genes" that carry information…

Q: Assume researchers are able to isolate the intact mRNA for a gene called qrs. The qrs mRNA isolated…

A: Messenger RNA is synthesized with the help of RNA polymerase taking the help of template strand of…

Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…

A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…

Q: 5. Refer to the text box about identifying the remains of the Russian royal family earlier in this…

A: When nuclear DNA is damaged or unavailable, mtDNA analysis is useful in forensic research, notably…

Q: What is the reasoning for ALP values in young adults and chidlren being double the values of adults.…

A: ALP is an enzyme found in various tissues in the body, including the bones, liver, and intestines.

Q: You should change it to ml

A: This is a lab experiment , here observe and understand what an enzyme is and its function. How…

Q: it might happen to your red blood cells if your blood solute concentration began to fall rapidly…

A: Blood performs many functions in our body. The main components of blood are red blood cell, white…

Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…

A: Amino acids are the structural units of proteins that are linked together by peptide bonds. There…

Q: e figure below shows an insect, pelican, and a magnolia tree. Please select at has the trait that is…

A: Cicadas show a extended life cycle with reproducing only once in their lifetime.Annual life cycle is…

Q: QUESTION 2 Most sensory stimuli are interpreted in: 00 the cerebrum sensory receptor cells O…

A: Actin is a crucial protein found in cells, particularly in muscle cells. It plays a fundamental role…

Q: What is the pH of these body fluids? 1. Ions 2. Electrolytes 3. pH 4. Acid 5. Base 6. Buffer

A: pH serves as a gauge of a solution's acidity or alkalinity and is determined on a scale spanning…

Q: The Swedish Botanist Carolus Liññáéus is recognized as the firs regarding the work of Linnaeus is…

A: Option 1: Linnaeus' work followed other Naturalists but his work was deemed unifying and so he…

Q: Sugar residues that are attached to proteins embedded within the plasma membrane, that play a role…

A: The question pertains to a fundamental aspect of cell biology and the structure of the plasma…

Q: CASE ANALYSIS Case: An 81 year old female brought in by her son for a medication evaluation. Her…

A: In this case, the patient is an 81-year-old female with a complicated restorative history and an…

Q: A set of hermaphrodite self-crosses and male x hermaphrodite crosses were established, and the…

A: A hermaphrodite is an organism that possesses both male and female reproductive organs within a…

Q: In the pedigree below what is the expected mode of inheritance?

A: Pedigree analysis helps us to understand the mode of inheritance of a particular trait (disease) by…

Q: Similarities of Prokaryotic Cells and Eukaryotic Cells Differences of Prokaryotic Cells and…

A: 1) Both cell has cytoplasm or the cell's fluid component, which is enclosed by a plasma membrane.2)…

Q: In humans, cystic fibrosis is a disease caused by a recessive allele (). Individuals with normal…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Name and describe 5 properties of cancerous or tumor cells from patients(in vivo) and of cancerous…

A: Cancerous cells are abnormal cells that grow uncontrollably, invade surrounding tissues, and can…

Q: Toll-like receptor stimulation in both myeloid dendritic cells and plasmacytoid dentritic cells will…

A: TLRs are type 1 trans membrane proteins that extend from one leaflet to the other leaflet of the…

Q: Sanger spectrophotometer Coulter counter plate counts centrifugation direct Petroff-Hauser turbidity…

A: Microbiology is the study of the biology of microscopic organisms - viruses, bacteria, algae, fungi,…

Q: See image

A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: What defects in the WNT signaling is a common cause of the human colon cancer

A: Cancer is a disease in which cells divide uncontrollably and abnormally. It destroys body tissue.…

Q: Show the calculations for the preparation of 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions…

A: The user is asking for calculations related to the preparation of various concentrations of a DNA…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: Calculez: 0.02cm+3.72mm+0.024m+230µm. Give the answer in mm (do not round off your answer, write…

A: A micrometer, often called a micron, is a unit of length in the metric system, symbolized as µm. It…

Q: Which of the following are the correct products of 1 turn of the Krebs cycle per glucose molecule?…

A: Before the Krebs cycle begins, oxidation of pyruvate obtained as a result of glycolysis takes place,…

Q: What is the relationship between an increase in fossil fuel consumption and increased carbon in…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: The following bacteria are Gram negative: Salmonella spp. and E. coli S. aureus and Streptococcus…

A: The following bacteria are Gram negative:Salmonella spp. and E. coliE. coli is a Gram negative, rod…

Q: In your own words, explain the difference between ancestral and derived traits.

A: The question relates to the field of evolutionary science, particularly centering on the concepts of…

Q: https://www.youtube.com/watch?v=FVuNTiqHys0 Do you think that animals like Koko who has the…

A: The hypothesis proposes that all species of life forms emerge and create through the natural…

Q: can derive nourishment from eating clothing made of natural fibers such as wool (which is rich in…

A: Clothes moth larvae possess a unique ability to nourish themselves by consuming clothing made of…

Q: 3. Quantitative – diffusion rate: Humans rely on their lungs to supply oxygen to their bodies. Each…

A: This question is about the diffusion of oxygen in the lungs, particularly under conditions affected…

Q: The most important factor guaranteeing a biochemical change is a. A positive ∆G b.…

A: At constant temperature and pressure, the amount of reversible work that may be extracted from a…

Q: Can science ever replace religion, or vice versa? How do people reconcile religious and scientific…

A: Science is the study of natural world which is helped by experimentation and reasoning.Religion is a…

Q: You are planting a cherry orchard with two rows of female fruiting trees. Below is a diagram of…

A: Plants that possess both the male reproductive part (stamen) and female reproductive part (pistil)…

Q: You are required to select your organisms from four different phyla. You cannot use the same phylum…

A: Phylum Mollusca:Organism: Giant Clam (Tridacna gigas)Taxonomic Structure: Kingdom: Animalia, Phylum:…

Q: cientists have seen the rate of growth of phytoplankton biomass across the Arctic Ocean increase by…

A: Phytoplanktons are the autotrophic components of freshwater or ocean ecosystemsIn the Arctic Ocean,…

Q: Phalaropes are shore birds with brightly colored females and dull colored males. Females are larger…

A: Sexual dimorphism is described and defined as the differences in size, looks, appearance, or…

Q: Several rounds of failure often precede most successful scientific discoveries. How did failure play…

A: James Watson and Francis Crick made one of biology's most significant discoveries—the discovery of…

Q: When two inbred plants with triangular pods were crossed, the Fi plants all had ovate The resulting…

A: This is definitely a cross in which an allele apart from the main allele also determines the pod…

Q: his is an image of a long bone. Identify "3" 1 4 5 6

A: Answer :- In these questions, we are asked to identify specific parts of a long bone from provided…

Q: Consider the pedigree of a family with an autosomal recessive disorder. Analyze the pedigree to…

A: Understanding genetic inheritance patterns is crucial in assessing the risk of individuals carrying…

Q: Protein processing pathway Match each description with the appropriate step in protein secretion.…

A: Proteins are produced by the ribosome by the translation process. Ribosomes bound on the membrane of…

Q: 2-4 sentences, compare the responses of voltage-gated Na+ and K + channels to polarization in…

A: While Comparing the responses of voltage-gated Na+ and K+ channels to the depolarization. Both the…

Q: bacterial replication fork

A: This is the site within a bacterial DNA molecule where the replication of DNA occurs actively.This…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduce about the bacteria

VIEW

Step 2: Explain the phagocytosis process

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Compare and contrast the following methods of a passing cell membrane in terms of movement with respect to the concentration gradient, use of ATP, and the use of transporters with examples. (Simple) Diffusion Facilitated Diffusion/Passive Transport Osmosis Active Transport Exocytosis Endocytosis (with its 3 subforms)
Which of the following are features of facilitated diffusion? There may be more than one correct answer, select all that apply. Requires energy Movement assisted by proteins Can include passive diffusion Depends on ATP hydrolysis Can include ion transport down its concentration gradient in a cell (high to low concentration)
Which of the following statements is correct about passive facilitated diffusion? (select all that apply) V It is a process in which molecules move from a region of lower concentration to one of higher concentration (or up a concentration gradient). O It requires a transport protein. O It requires an expenditure of energy by the cell. O It is a process in which molecules move from a region of higher concentration to a region of lower concentration (or down a concentration gradient). O It involves movement of molecules up a concentration gradient and requires a transport protein.
The surface area to volume ratio affects the ability of the cell to exchange nutrients and waste products with the outside environment. Many factors affect the movement of molecules across the cell membrane, including membrane thickness, temperature, pressure, concentration gradient, molecular mass, distance travelled, solvent properties and surface area of the cell. In general, according to Einstein’s approximation equation (Equation 1), diffusion time is inversely proportional to the to the diffusion coefficient (D), where t is time and x is distance travelled. The diffusion coefficient is unique to each type of molecule and is determined experimentally. Waste products such as carbon dioxide (CO2) pose a unique problem to cells as their accumulation may be lethal. Exchange with the external environment is dependent upon the distance the waste must travel; for a round cell this will be up to half the cell diameter. Using the diffusion coefficient (D) for carbon dioxide (1.97 × 10-5…
This graph shows facilitated diffusion of a compound across a cytoplasmic membrane and into a cell. As the external concentration of the compound is increased, the rate of uptake increases until it reaches a point where it slows and then begins to plateau. This is not the case with passive diffusion, where the rate of uptake continually increases as the solute concentration increases. Why does the rate of uptake slow and then eventually plateau with facilitated diffusion?
The following are true statements regarding passive facilitated transport EXCEPT The process is always thermodynamically favorable. It uses the same driving force as that of active transport. The movement of solute acrosss the membrane is dictated by existing concentration or ion gradient. It requires a carrier protein which is an integral membrane protein.
What type of function is performed by SGLT (sodium glucose cotransporter), which uses the energy stored in the high concentration of sodium to move glucose against their concentration gradient? Group of answer choices Simple diffusion Secondary active transport Primary active transport Facilitated diffusion
what are the correct terms for each letter? Answer choices below primary active diffusion , Potassium, Glucose, Secondary active transport, SODIUM, Facilitated Diffusion, simple diffusion.
The transportation of relatively small particles or liquids into the cell that are too big or unable to pass through a transport protein is best described as ________. pinocytosis phagocytosis exocytosis facilitated diffusion diffusion
Define: simple diffusion, facilitated diffusion, primary active transport, secondary active transport and cotransport (by sure to address symport and antiport) . please explain this iin one sentense for each one please. note: I do not want more than one sentense
Simple diffusion is __________ active passive a form of active transport dependent on ATP
Which of the following are features of facilitated diffusion? Select all that apply. lon transport with its concentration gradient (from high to low) lon transport that requires energy lon transport assisted by proteins lon transport associated with ATP hydrolysis