RBC metabolism pls explain as simple
Q: Mitochondria are considered to be the powerhouses of eukaryotic cells because they produce ATP,…
A: Citric acid cycle metabolizes acetyl-coA derived from glucose. Fermentation of lactic acid produces…
Q: Match the following biogeochemical cycles terms to the correct definiton. In this cycle the…
A: Introduction: The term biogeochemical cycle is a natural process that recycles nutrients from the…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: A 2x10-6 dilution of your bacterial culture yielded 10 colonies. What was the cell density (in…
A: The purpose of dilution of the bacterial culture before plating is to ensure that the cells are are…
Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…
A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: What type of monomers make up proteins? What are protein polymers called?
A: Note - Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: Food Sample marshmallows Pumpkin seeds cracker Dried cranberries рорсorn Rice cake almond
A: Calorific value of foods is based on their nutrient content. Calorific value of foods is the total…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: Four substances ATP, CoA-AH, FAD and NAD+ are given. Here, we have to identify the subunits in their…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Consider the Protein (P) is getting bound by the Ligand (L) to form the Protein-Ligand complex (PL)…
Q: rilling fatty meats over glowing charcoal produces a volatile, pungent chemical which causes…
A: Introduction: A chemical reaction is a process of breaking chemical bonds in one or more substances…
Q: On the right the Hill plot com- (b) pares the O2 binding properties of Hb Ya- kima with those of HbA…
A: The Hill plot given in the diagram shows the allosteric regulation and affinity of the different…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: There will be three graphs. They as given below:
Q: Why water is polar while carbon dioxide is not?
A: Polar molecules are the molecules with different poles with two different charges. The two different…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…
A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Cell membranes are composed of a lipid bilayer. How does the type of lipid bilayer affect its…
A: The cell membrane is composed of a phospholipid bilayer.
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: While fatty acids are most often formed by the condensation of_-carbon units, isoprenoids are…
A: Fatty acid and isoprenoid both are class of lipid and plays an important role in the metabolism of…
Q: Polysaccharides may gel through a variety of different mechanisms. Which of these statements is…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: 12. You can distinguish epinephrine hydrotartrate from norepinephrine hydrotartrate by: A. Water…
A: Hi, thanks a lot for submitting the multiple questions. As we are allowed to answer one question at…
Q: 1. Why a peptide bond can't rotate freely? 6%. 2. The and are two amino acids usually will break an…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Question 6 A ceramide with a single sugar is called? Sphingomyelin Ganglioside Plasmalogen…
A: Ceramides : Waxy lipid molecules. It consists of the sphingosine and a fatty acid, within the cell…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…
A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Nutrition Facts Calories 112 Total Fat 0g Total Carbohydrates 21 g Protein 7g What percentage of the…
A: Introduction: Calories are the amount of energy or heat that takes to raise the temperature of one…
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: n the discovery of new drugs, the chemical and physical properties of a molecule are very important…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: What process do all macromolecules have in common?
A: Biological macromolecules are always categorized as organic molecules because they include carbon in…
Q: 1. Proteins act as structural components such as keratin of hair and nail, the collagen of the bone…
A: "Since you have posted a question with sub-parts we will answer the first 3 question for you. If you…
Q: 3. sports amp. Intensively pool for 120 minutes two hours after each meal. What metabolic changes of…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: Concentration Substrate/Cofactor (nM)
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
What is RBC
pls explain as simple as posssible
Step by step
Solved in 3 steps with 1 images
- What is Embden-Meyerhof pathway of RBC metabolism, explain as simple as possibleExplain why it would be not possible to accurately measure hemoglobin concentration if the RBCs were not first lysedPernicious most common in older pe people Which choices list the correct relationships among the factors that cause this disorder? -The reduced synthesis Vitamin B 12 results in the production many platelets. -The reduced af intrinsic factor means that vitamin cannot be absorbed, and many red blood cells are destroyed -The reduced secretion intrinsic factot that vitamin carinot bo absorbedand macrocytes are produced instead of erythrocytes -The increased secretion of intrinsic in excess levels of Vitamin causes the synthesis of too many red blood cells for the to break down.
- Blood is mostly...? O dissolved solutes O water O platelets O red blood cells O white blood cellsAB negative blood can be and can not be donated to which blood groups? Explain with reason.An elderly woman in a nursing home was foundto have anemia dueto a vitamin deficiencyand was also found t obedisoriented withmemory loss. What vitamins can cause anemia but whatvitamincaused her change in mentalstatus?What 2 pyramid foodsgroups provide the vitaminshe showed signs and symptoms for? What vitamin may she have been taking, at what dose, that hid her deficiency from showing up in routine lab tests? pls help asap and explain correctly everything. Thank you
- In two complete sentences tell me the definition of a reticulocyte and why would we see an increase of them in the circulating blood BIUA - A - I E E 3 X x, = E Paragraph 12pt frA junior medtech working on a night shift. You were assigned to the blood banking section of the laboratory where you are designated to test blood for crossmatching and release blood bags. You release O positive blood bag for a patient with anemia. After 10 minutes, the nurse called and said that the patient is having a "reaction" to the said blood and told you to investigate and re-checked. What are the relative effects if the problem is unsolved in relation to the: medtech, laboratory, hospital, and patient?discuss in detail the normal physiology of RBC production.
