Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?
Q: In their occurance, describe non essential amino acid biosynthesis, amino acid catabolism, fatty…
A: Non-essential amino acids are those that the body can synthesize on its own. This biosynthesis…
Q: This is a diffusion topic: During the time the simulation ran, did the concentration of either the…
A: Everything taking place within a lifeform, from reactions to molecular transport, strives to attain…
Q: Match each stated goal to the most relevant method, technique, or procedure for achieving that goal.…
A: Separation of proteins is the process of isolating and purifying individual proteins from a mixture…
Q: Which of the following coenzymes are required for the metabolic reactions that convert glycerol…
A: Gluconeogenesis is a metabolic pathway that occurs primarily in the liver, but also to a lesser…
Q: A hypotonic solution is one that adds water to the cell. A hypertonic solution removes water from…
A: Cellular biology depends on the delicate dance of water and solutes across cell membranes. Solutions…
Q: R. Зо-сод 2 COA 3 R What is the correct order of the intermediates as they appear in the B-oxidation…
A: A fatty acid is a biomolecule that is made up of carboxylic acid with an aliphatic chain. This…
Q: Problem #5 What is the available chlorine in tri-chloramine (tricholoronitrogen)? For a 4.5 log…
A: The chemical compound trichloramine (NCl3), commonly known as nitrogen trichloride or trichloramine,…
Q: When one categorizes a protein's structural classification, they sort different proteins primarily…
A: Amino acids are defined as organic compounds that form the core structure of proteins and gives them…
Q: Biochemistry. is there anyone refer me regarding lactic acid from whey?
A: Certainly! To make lactic acid from whey, consult experts or scientific sources. Check outthese…
Q: Vmax for an enzyme-catalyzed reaction: A) generally increases when pH increases. B) is…
A: Answer- The maximum rate of an enzyme-catalyzed reaction determiine Catalytic efficiency…
Q: Which of the following are true about the glyoxylate cycle? (select all that apply) Group of answer…
A: 1.Certain organisms have a metabolic mechanism called the glyoxylate cycle that helps them meet…
Q: Which of the following statements is true? A. In general, the metabolic oxidation of protein in…
A: Metabolic oxidation refers to the process by which organic molecules, such as carbohydrates, fats,…
Q: 1. Imagine you are trying to explain the process of cellular respiration to your friend who is also…
A: Cellular respiration is the process by which cells generate energy by converting glucose and oxygen…
Q: The figure below summarises glycogen metabolism. Use the figure to answer the question: Hexokinase…
A: The term "well-fed state" describes a physiological condition in which a person has recently eaten…
Q: Assume that an inhibitor (I) can bind to an enzyme and is modified by the enzyme. The modified…
A: Enzyme inhibitors are the molecules are the chemical compounds that bind to the enzyme to influence…
Q: 15. Which of the following amino acid residues would most likely be buried in the interior of a…
A: Protein Folding is a process by which a simple peptide chain is folded to get a functional 3-D…
Q: Can you explain to me why choice E is the correct answer and break down why the other options are…
A: Resting potential is the membrane potential when the neurons are not sending electrical signals,…
Q: Activation of cAMP phosphodiesterase _________________________. Stimulates the phosphorylation of…
A: cAMP is a second messenger that regulates various cellular functions, including glycogen metabolism.…
Q: In the disease familial hypercholesterolemia (inherited tendency for high blood LDL cholesterol…
A: Familial hypercholesterolemia (FH) is a hereditary condition characterised by elevated blood levels…
Q: Where is the N-terminus of this peptide? Left Middle Right b) What type of secondary structure is…
A: The primary structure of a polypeptide ( or simply a peptide) is its amino acid sequence from the N…
Q: Explain what proteins are and why they are important. Include essential, nonessential, and…
A: Amino acids are the building blocks of proteins, consisting of a central carbon atom bonded to an…
Q: Predict the order of the melting points of triglycerides containing fatty acids, as follows: From…
A: Fatty acids are defined as the hydro carbon chains which act as building blocks of fats.These are…
Q: Why does epinephrine stimulate glycolysis? I know why epinephrine stimulates glycogenolysis which is…
A: You are correct that epinephrine stimulates glycogenolysis to release glucose stores. However, it is…
Q: Assume that you have genetically modified the gene for the glucagon receptor in a rat.…
A: The glucagon receptor is a G protein-coupled receptor (GPCR) that plays an important role in lipid…
Q: depicts the effect of an inhibitor on the initial velocity (Vo) of an enzyme at different substrate…
A: Enzyme inhibition depends on the inhibitors and their action is seen by the Lineweaver Burk plot…
Q: The kcat and KM for chymotrypsin-catalysed cleavage of a synthetic substrate, S, were determined to…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 3. (ii) Examine this pentapeptide and answer all parts (i) to (v) glutamic acid threonine НО. NH₂…
A: Antiparallel beta-sheet () has the polypeptide strands running antiparallel i.e. the amino to…
Q: Which of the following is true for role of glucose-6-phosphate in the regulation of carbohydrate…
A: Glucose-6-phosphate is a central molecule in carbohydrate metabolism, involved in glycolysis,…
Q: 30. Discuss the source of the inputs (where do they come from) and what occurs with the outputs…
A: The answer discusses computing and AI inputs and outputs. Users, data streams, databases, APIs, and…
Q: The image below shows ubiquinone. Shaded in yellow is the isoprenoid side chain, which remains…
A: Ubiquinone is present in the mitochondria of all eukaryotic molecules. this molecule is fat-soluble…
Q: ● 1.) Arrange the following enzyme activities in order that they first appear in the biosynthesis of…
A: Here's a detailed explanation of the biosynthesis of stearoyl CoA in the cytosol of the liver cell,…
Q: 40. Propose that all three carbon atoms in glycerol is labeled with 14C. The labeled glycerol is…
A: Glycerol is a molecule commonly found in biological systems and serves as a precursor for various…
Q: 3. Why glycogen in muscle cells cannot be stained blue-black by iodine solution?
A: The test is based on the interaction between the amylose polymer of carbohydrates and iodine. Iodine…
Q: Match the description on the left with the terms on the right. A component of cytochromes Exist in…
A: Both hemoglobin (Hb) & myoglobin (Mb) are globular proteins.Hemoglobin help to transport oxygen…
Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…
A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…
Q: 32. What are the factors to consider in measuring liquids?
A: Scientific, industrial, and everyday applications require accurate liquid measurements. Several…
Q: Which of the following is not a component of the citric acid cycle? Group of answer choices…
A: [Because You post so many question in single question I will give you the first two answers only…
Q: 63. Given the single stranded DNA shown below (written 5' to 3') and the genetic code, which…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Which of the following statements is true? a. Plotting the rate of facilitated transport against…
A: Facilitated transport, also known as facilitated diffusion, is a mechanism of passive transport that…
Q: A sequence of amino acids in a certain protein is found to be -Ser-Gly-Pro-Gly-. The sequence is…
A: An amino acid is a component of proteins and is essential for many biological activities. The…
Q: Draw a general diagram of a triglyceride. Describe the various types of biologically important…
A: Lipids are a broad group of biomolecules that are characterized by their hydrophobic or nonpolar…
Q: In the clinical case scenario provided, match the defective enzyme in Column A with the consequence…
A: Defective enzymes leads to compromised metabolism within individuals. This would lead to health…
Q: List two denaturants and one reducing agent that are commonly used in protein chemistry.
A: Denaturants interacts with the non-covalent interactions within the native structure of proteins…
Q: The pH of a fruit juice is 4.8. Find the hydronium ion concentration, [H3O*], of the juice. Use the…
A:
Q: 38. The shown reaction is one of the four repeating steps during fatty acid biosynthesis. Which of…
A: The process through which all the living things, including plants and animals produce fatty acids,…
Q: 38. The shown reaction is one of the four repeating steps during fatty acid biosynthesis. Which of…
A: The process through which all the living things, including plants and animals produce fatty acids,…
Q: 1/Vo 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0 0 1 2 3 1/[S] (MM-¹) 4 y = 0.005x + 0.0337 R² = 0.95 y =…
A: In Michaelis- Menten equations, It is very difficult to determine Vmax and Km. Therefore, to…
Q: 11. Calculate K and Vmax from the following data: [S] (µM) 0.1 0.2 0.4 0.8 1.6 vo (mm. s¯¹) S 0.34…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: (a) What is the theoretical yield of ATP/NADH using the measured change in free energy of -208…
A: Change in free energy for 1 mol of NADH = - 208 kJ (Negative sign indicates the release)Change in…
Q: 27. What are the symptoms of diabetes mellitus?
A: Pancreatic islets of Langerhans contain specialized endocrine cells. These islets contain beta and…
Step by step
Solved in 3 steps
- Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…Restriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
- No Genome Left Behind and the Genome 10K Plan. Explain about this ?How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below. Let’s say this DNA is used in a Sanger Sequencing reaction. How long (in nt) will dev the shortest RED nucleic acid chain be given that the red fluorophore is attached re to the ddCTP?The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?