Answered: Question 9 of 10 Question 9. If a…

Name: Question 9 of 10Question 9. If a mutation occurs such that there isa
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 9 of 10Question 9. If a mutation occurs such that there isa duplication of the A in the 3rd codon of theMRNA sequence below. This is called amutation.5' - AUG CUC UAC-3'

Science

Biology

Question 9 of 10 Question 9. If a mutation occurs such that there is a duplication of the A in the 3rd codon of the MRNA sequence below. This is called a mutation. 5' - AUG CUC UAC- 3'

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

Question 1 I . Protein Synthesis – complete the chart for this coding region of a gene. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acid
Question 7 of 10 Question 7. What are the first three amino acids in the protein that is produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGATGGCTAGT... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCTACCGATCA.. 5' Start site
Question 4 The stages of transcription includes the followings except RNA processing O initiation O elongation O termination
Question 3 If the codon AAA is changed to AGA, it codes for a new amino acid; this is an example of a silent mutation. gross mutation. nonsense mutation. frameshift mutation. missense mutation.
Question 27 To make RNA the nucleic acid sequences get read in thedirection Sense → Antisense O Template → Partner O 3' → 5' O 5' → 3'
QUESTION 9 Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O Polyadenylation O Rho-dependent termination Splicing Capping
Question 2: Mutations - Create a nonsense point mutation in this coding region of the gene. Make sure to highlight the mutation you made using a different color or highlighter. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acid
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer
Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
QUESTION 23 Which of the following is not part of pre-mRNA processing in eukaryotes? Addition of a 5’ cap Excision of introns Addition of a 3’ poly-A tail Excision of the promoter
Question 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly G
Question 23 Which of the following is not part of pre-mRNA processing in eukaryotes? a Addition of a 5’ cap b Excision of introns c Addition of a 3’ poly-A tail d Excision of the promoter