Question 2 -Which of the following is required for import of mitochondrial matrix proteins?(select all that apply)N-terminal import sequencesignal recognition particlesignal recognition particle receptorGTPATPimport sequence receptorQuestion 3,What is the source of energy needed for unidirectional translocation across themembrane in (a) post-translational translocation into the ER; (b) translocation intothe mitochondrial matrix; and (c) cotranslational translocation into the endoplasmicreticulum (ER).ATP hydrolysis in all casesGTP hydrolysis in all cases(a) ATP hydrolysis; (b) GTP hydrolysis; (c) ATP hydrolysis(a) GTP hydrolysis; (b) ATP hydrolysis; (c) GTP hydrolysis(a) GTP hydrolysis; (b) ATP hydrolysis; (c) ATP hydrolysis(a) ATP hydrolysis; (b) ATP hydrolysis; (c) GTP hydrolysisnone of the above

Most of the enzymes and other proteins required by mitochondria is encoded by the nucleus, despite…

Answered: Question 2 - Which of the following is…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 15P

See similar textbooks

Similar questions

Question 7 What experiment could you perform to test if KDEL is necessary for protein retention in the ER? What information needs to be encoded in the test mrotein for this experiment? Please be brief, but make sure I. you are clear about what features need to be encoded on the test protein.
please help explain Influenza A virus M2 protein triggers mitochondrial DNA-mediated antiviral immune responses Cytosolic mitochondrial DNA (mtDNA) activates cGAS-mediated antiviral immune responses, but the mechanism by which RNA viruses stimulate mtDNA release remains unknown. Here we show that viroporin activity of influenza virus M2 or encephalomyocarditis virus (EMCV) 2B protein triggers translocation of mtDNA into the cytosol in a MAVS-dependent manner. Although influenza virus-induced cytosolic mtDNA stimulates cGAS- and DDX41- dependent innate immune responses, the nonstructural protein 1 (NS1) of influenza virus associates with mtDNA to evade the STING-dependent antiviral immunity. The STINGdependent antiviral signaling is amplified in neighboring cells through gap junctions. In addition, we find that STING-dependent recognition of influenza virus is essential for limiting virus replication in vivo. Our results show a mechanism by which influenza virus stimulates mtDNA release…
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCOCTACGTGATAG...3' promoter A) Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'
Question 6A You gather the following data on the expression of a eukaryotic gene which experiences positive gene regulation (induction). What the gene product is or how it is induced is not important for understanding the problem. The numbers indicate the amounts of product seen at each stage listed (what the units are isn't important either). At what stage of the gene expression process is the production of the gene's protein being affected? What data leads you to think this? Remember, this is a eukaryote. Induced Uninduced Transcription initiation 100 4 Poly-A pre-MRNA 95 Spliced mRNA 93 MRNA in the cytosol (t=0) 92 4 MRNA in the cytosol (t=60 85 min) Total protein product 300 1 (t=60 min)
Effects of BPA on phosphorylation of MAPKfamily in RAW264.7 cells conclusion
Question 5 What is the role of TRF2 at the telomere? extends the 3' end of the G+T strand O packages DNA into heterchromatin O forms a platform for microtubule attachment O facilitates formation of the t-loop at the telomere and recruits RAP1
Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -
15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…
Question:- what are the differences between mitochondrial RNA polymerase and RNA polymerase ? and why does mitochondrial RNA polymerase does not get identified or determined by the purification of RNA polymerase activity by chromatography ?
Asap
Question 9B Why are host cell antiviral responses that target double-stranded RNA effective against single- stranded RNA viruses like influenza or coronaviruses? Would a system that responds to the presence of double-stranded RNA be effective against retroviruses? Explain.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS