>Question 2Which of the following are factors that can influence mutation rates? Mark all that apply.the genetic codenucleotide repeatsOphenotypeNone of these influence mutation ratesgene size

Name: >Question 2Which of the following are factors that can influence muta
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: >Question 2Which of the following are factors that can influence mutation rates? Mark all that apply.the genetic codenucleotide repeatsOphenotypeNone of these influence mutation ratesgene size

Abrupt changes in the original DNA sequence is called mutation. This may or may not have a drastic…

Answered: Question 2 Which of the following are…

Science

Biology

Question 2 Which of the following are factors that can influence mutation rates? Mark all that apply. the genetic code Onucleotide repeats Ophenotype None of these influence mutation rates gene size

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutation
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
Plssssss helppppp Explain why there is a phenotypic change in insertion and deletion point mutations?
When considering the mutational options for a nucleotide such as thymine, there is a single transition and two transversion type mutations that are possible, which is why we observe transversions to occur more frequently in nature when genomes are examined. O True O False
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
The table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚC
Select all the possible mutation types for the following observed phenotype resulting from a mutation in a coding gene: A protein is made but is shorter with an abnormal shape, and no enzymatic activity. a non conservative missense mutation O an in-frame indel of 1 amino acid Oa frameshift a nonsense mutation Oa mutation in one splice site
Mutation rates vary for genes. All of the following are factors that influence the mutation rate of a gene EXCEPT: O repetitive nucleotide sequences size of the gene spontaneous chemical changes: C/G base pairs are more likely to mutate than A/T pairs O all of these factors influence gene mutation rates exposure to environmental triggers
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
. Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells containing each mutation alone or in combination with othermutations was measured when the cells were grown inmedium with different carbon sources.Lactose +Glycerol Lactose GlucoseWild type 0 1000 10Mutant 1 0 10 10Mutant 2 0 10 10Mutant 3 0 0 0Mutant 4 0 0 0Mutant 5 1000 1000 10Mutant 6 1000 1000 10Mutant 7 0 1000 10F′ lac from mutant 0 1000 101/ mutant 3F′ lac from mutant 0 10 102/ mutant 3Mutants 3 + 7 0 1000 10Mutants 4 + 7 0 0 0Mutants 5 + 7 0 1000 10Mutants 6 + 7 1000 1000 10Assume that each of the seven mutations is one andonly one of the genetic lesions in the following list.Identify the type of alteration each mutation represents.a. superrepressorb. operator deletionc. nonsense (amber) suppressor tRNA gene (assumethat the suppressor tRNA is 100% efficient in suppressing amber mutations)d. defective CRP–cAMP binding sitee. nonsense (amber) mutation in the β-galactosidase genef.…
G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected