Q11: You are comparing the process of RNA splicing in an mRNA from normal and mutant cells of the same tissue. You find that the mutant mRNA is longer than the mRNA from the normal cells. Examination of the sequences of the gene encoding this mRNA reveals that there are nucleotide changes at the boundary of one of the exons in the mutant cell gene. Which of the following nucleotides would be expected to be found at the 3' end of upstream donor exons and the 5' end of downstream acceptor exons in the normal gene but not in the mutant gene? A. AG-G B. AG-AG C. CA-GA D. G-AG E. CG-G

Q11: You are comparing the process of RNA splicing in an mRNA from normal and mutant cells of the same tissue. You find that the mutant mRNA is longer than the mRNA from the normal cells. Examination of the sequences of the gene encoding this mRNA reveals that there are nucleotide changes at the boundary of one of the exons in the mutant cell gene. Which of the following nucleotides would be expected to be found at the 3' end of upstream donor exons and the 5' end of downstream acceptor exons in the normal gene but not in the mutant gene? A. AG-G B. AG-AG C. CA-GA D. G-AG E. CG-G

Name: Q11: You are comparing the process of RNA splicing in an mRNA from no
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Q11: You are comparing the process of RNA splicing in an mRNA from normal and mutant cells of thesame tissue. You find that the mutant mRNA is longer than the mRNA from the normal cells.Examination of the sequences of the gene encoding this mRNA rev

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 12TYK: Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is...

See similar textbooks

Similar questions

Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5'.atacaATGCATGTCAaCTAcgaagatccgTAGaTAACATtCATatc...3' Suppose the underlined, bold a were mutated to be a t. Write the new sequence of your MRNA transcript below and underneath it the new amino acid sequence of the peptide it а. encodes. b. What kind of mutation would that be?
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicing
1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.