pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb How many times does the enzyme BamHI cut? 1 2 3 4
Q: One of the biggest challenges for stimulating economic growth in high-income countries is Question…
A: Economic growth can be determined as a rise over time in the amount of products and services…
Q: What is the end product of fermentation? Lactic acid Oxygen Ethanol Two of the above
A: Introduction :- Through the activity of enzymes, fermentation is a metabolic process that results in…
Q: Addison's disease is a hormonal disorder that results from inadequate hormone secretion by the…
A: The adrenal glands (or suprarenal glands) are paired glands, each about 4-6 cm in length and 3-4 cm…
Q: What is the significance of mRNA?
A: Introduction Messenger ribonucleic acid, or mRNA, is a single-stranded molecule that is present in…
Q: 1 mL of a bacteriophage suspension is mixed with 20 mL of a bacterial culture and 50% of the phages…
A: Given information Volume of bacteriophage = 1ml Volume of bacterial culture= 20 ml Concentration of…
Q: I want more information about this information
A: we have to explain the effect of salinity on wheat seed germination.
Q: How does regeneration of tissue differ from repair of tissue?
A: Introduction Following a tissue injury, two different types of processes are started that rebuild…
Q: 7- The material used in culture techniques is important because the surface of the vessel serves as…
A: Cell culture is the process by which cells are grown in an artificial environment, often outside of…
Q: Distinguish between innate and acquired immunity.
A: Immunity is the body's defensive mechanism against the various pathogens. It can helps in…
Q: What is the frequency of the B allele if allele b has a frequency of 0.24 and what are the three…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: The patient sees a doctor about some dermatological problems. After medical examination the doctor…
A: Parasites are creatures that live in or on a host and rely on it for food, housing, and…
Q: Write down the data-reduction techniques.
A:
Q: Below are the results from a 3 gene testcross between an XxYyZz plant and an xxyyzz plant: Testcross…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Which of the following is NOT a reason why middle-income countries in the east have experienced…
A: Middle-income countries in the east have huge technological developments.
Q: Explain the two major drawbacks of phenotypic testing methods that require culturing the pathogen.
A: The phenotypic approaches involve identifying bacteria by taking into account their behaviour and…
Q: What are three mechanisms pathogens use to block the immune system?
A: Introduction The body's defence against infection is provided by the immune system, a vast network…
Q: The DNA strand whose %T is 50% DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C…
A: According to Chargaff's rule, there is always equality in quantity between the bases A and T and…
Q: Answer the following questions in two to three sentence! Cerebral Enhancer Jure you in favor of the…
A: The phenotype of an organism or individual is a complex interaction between the genome and the…
Q: Describe the three different tests that fall in the direct identification category.
A: Microbes are generally termed to state that they are living things that cannot be seen with the…
Q: Why is the development of recurrent or unusual infections the clinical hallmark of immunodeficiency?
A: Introduction :- The immune system's components, such as lymphocytes, phagocytes, and the complement…
Q: Bacteria and dust particles are moved back up the bronchiole by the sweeping motion of the: Cilia…
A: Introduction :- Layers of smooth muscle make up the bronchioles, which enable bronchodilation and…
Q: What is the survival value of semiconservative reproduction of DNA? : What is the survival value of…
A: Introduction :- The biological process of reproduction is how new, distinct creatures, or…
Q: the biological source of the enzyme, how the enzyme is part of a metabolic process in its biological…
A: NOTE: Please note that as per our company's honor code we are not allowed to cite external…
Q: Pretend you are a molecule of glucose in a chain of starch. Follow your breakdown from starch to…
A: A monosaccharide, which has six carbon atoms and one aldehyde group, is the most basic type of…
Q: What are the most important characteristics of coronary glass
A: What are the most important characteristic of coronary glass?
Q: Which of these components is unique to RNA (rather than DNA)? uracil thymine adenine guanine…
A: the correct answer is "uracil ".…
Q: slowing of population growth). In Step 1, we explore the effect of changing the age of reproduction,…
A: In 4th graph, population in aye group of 0- 4 are nearly 50 million and reduces in subsequent age…
Q: When does a cell become irreversibly injured?
A: Introduction :- The smallest unit in biology that can sustain life on its own and makes up all…
Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…
Q: Differentiate communicable disease and contagious disease.
A: Communicable disease are all are infectious. But all contagious disease are not infections..
Q: Which of the following occurs during ventricular diastole? a-The ventricles contract to force blood…
A: During ventricular diastole, the following occur- b- The ventricles relax and refill with blood c-…
Q: Which of the following best describes a hypotonic solution? a-There is a higher concentration of…
A: Introduction :- The solution is said to as hypotonic if the concentration of the surrounding…
Q: Why is mercury (Hg) poisonous to humans? What does it do once it gets in our bodies?
A: Mercury (Hg) is poisonous to humans And once it gets into our bodies is;-
Q: what are the details of (initiation, elongation, and termination) in Central Dogma
A: A linear polymer of nucleotides known as a "nucleic acid" is a part of the cell's…
Q: The potential difference that must be met in order for an action potential to be generated When the…
A: Action potential An action potential is defined as an electric impulse that travels down through a…
Q: Describe the term SDS-PAGE.
A: Charged particles migrate during electrophoresis under the influence of an electric current. For…
Q: What are pattern recognition receptors?
A: Introduction :- Proteins called Pattern Recognition Receptors (PRRs) can identify chemicals…
Q: Describe the term VIROIDS.
A: A pathogen, often known as an infectious agent, is a biological entity that afflicts its host with…
Q: Determine the connection between the sign (elevated antibodies and the symptom (thrombosis).
A: The situation in which a blood clot forms and blocks a blood vessel in the cardiovascular system is…
Q: Gel electrophoresis can be used to separate DNA on the basis of: A. the probe used. B. size.…
A: Electrophoresis is a laboratory technique used to separate DNA, RNA or protein molecules. Agarose…
Q: How does an increase in capillary hydrostatic pressure cause edema?
A: Introduction: Edema is described as a perceptible swelling brought on by an increase in the volume…
Q: A piece of mRNA is moving along the ribosome. Which amino acid would bind if the mRNA read....…
A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…
Q: Describe the Eukaryotic DNA Replication ?
A: Introduction: DNA is the genetic material found in the nucleus of the cell that contains the…
Q: Evaluate the statement: “Epigenetic information is highly dynamic in early development.”
A: Introduction Similar DNA is present in all of the cells of an organism, but varied gene expression…
Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…
A: Translation Process by which the mRNA codes for a particular protein is known as translation.
Q: Describe what are the enzymes and proteins involved in DNA replication?
A: DNA replication is the process of duplication of DNA molecule. It occurs during cell division. It's…
Q: What are the different types of T cells, and what function does each have?
A: Introduction :- T cells are produced by stem cells in the bone marrow and are a component of the…
Q: Describe SDS page.
A: Charged particles migrate during electrophoresis under the influence of an electric current. For…
Q: Explain why the following statement is false: Sexual reproduction is the only mechanism for genetic…
A: Explain why the following statement is false: Sexual reproduction is the only mechanism for genetic…
Q: 1. what is the layer of adrenal gland which produces epinephrine called 2.what is the chemical…
A: Answer-----
-
pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below:
EcoRI: 20 kb
BamHI: 11 kb, 6 kb, 3 kb
EcoRI + BamHI: 8 kb, 6 kb, 3 kb
How many times does the enzyme BamHI cut?
1
2
3
4
Step by step
Solved in 2 steps with 1 images
- pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the BamHI/EcoRI double digest produces only 3 fragments what are their sizes, why is this so? There are two 3 kb fragments There are two 6 kb fragments There are two of the same size fragments, but we don't know which. We cannot determine this from the information given.pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the double digest produces 4 fragments, with only 3 sizes what is the largest fragment size? 3.0kb 4.0kb 2.0kb 8.0kbpMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb What is the largest fragment size that the BamHI/EcoRI double digest produces? 2.250 kb 2.500 kb 2kb 8 kb
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
- . The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.m.Which intron interrupts a codon?n. Which intron is located between codons?o. Where would you be likely to find the site specifyingpoly-A addition?
- . The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
