Please I need both Question 21 ldentify the tissue that makes the sentence false. Ketones can be measured in the O Urine O Breath O Hair O Blood Question 22 Which exercise type uses oxygen during energy metabolism and allows for long term duration? O. aerobic O. anaerobic O all of these use oxygen

Q: Describe the pathogen that causes “The Flu”. What happens you get the flu and how did you most…

A: The flu spreads through respiratory droplets and aerosols. Typically, influenza is contagious from…

Q: Define what a pneumonia is, including what tissues are involved and what the consequences are for…

A: A bacterial, viral, or fungal infection of the lungs is known as pneumonia. Alveoli, the air sacs…

Q: all of his sons   all of his daughters   half of his daughters and half of his sons   half of his…

A: X- inactivation or lyonization is a process in which one of the X- chromosome is inactivated in…

Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…

A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…

Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?

A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…

Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…

A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…

Q: In a homeostatically regulated system, diagram or identify the regulated homeostatic variable,…

A: External substances that disrupt the generation, secretion, distribution, metabolic activity,…

Q: Which of the following is NOT necessary for speciation to take place? Genetic divergence Physical…

A: Speciation is the evolutionary process by which a new species arises from an existing one. It…

Q: What is the purpose of the confirmed test in an experiment designed to test for coliform bacteria?

A: Coliform bacteria are either nonmotile or motile, Gram Negative, bacilli bacteria. These are found…

Q: Which of the following hypothetical islands would likely have the greatest species richness?

A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…

Q: What are some benefits that come with sexual reproduction? Please select all correct answers. a.…

A: Reproduction is a biological process possessed by living organisms to promote their number in nature…

Q: When will arm span and knee height be used? Are there any limitations on using these two methods?

A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…

Q: Describe the morphology of radular teeth in the Gastropoda species

A: Introduction  The radula  is the vital feeding organ and also very significant to the majority of…

Q: Next, it's important to understand how the gene would be transcribed and translated. 1 agagtctcct…

A: i. Coding region of this gene is 288 nucleotide long.  ii. We all know that exons are the coding…

Q: Distinguish between innate and learned behavior. Explain how an experiment using optogenetics could…

A: 1.innate behaviorsautomatic, fixed, "built-in", no "learning curve"despite different environments,…

Q: Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O…

A: Introduction:- DNA ( Deoxy-ribonucleic acid) is a polymer of deoxy-ribonucleotide units, they are of…

Q: What occurs during food digestion? O Energy in large molecules is used to make ATP. O Energy from…

A: The process through which the food we eat moves through our bodies for the formation of new cellular…

Q: Which of the following is luminous? ⦁    Star ⦁    Bird ⦁    Cup ⦁    Bat ⦁    Stapler

A: Our solar system consists of several planets revolving around Sun. When we look above in the sky we…

Q: What are the specific roles of growth factors in a bacterium.

A: Growth factors are molecules naturally present in the body that stimulate cellular growth,…

Q: Animals: -coordinate muscle movement using their nervous systems. -rely on cell walls for support.…

A: Not all animals possess nervous systems,  (example: porifera) therefore option 1 is incorrect.…

Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.

A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…

Q: Mrs. and Mr. Bond have five children, Janine, Jaliyah, Joliette, Jelani and James Jr. Mr. Bond…

A: Given information  Fragile X syndrome is an X-linked dominant disease. Mr. Bond has this disease…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: 1. Related of HIV (Tick the appropriate box) Risk group Medical Male Circumcision reduces the risk…

A: The two Lentivirus species that infect humans are the human immunodeficiency viruses (HIV).…

Q: Protein structure is central to our understanding biological systems. The tubular proteins that make…

A: Primary, secondary, tertiary, and quaternary structures are the four levels of complexity that can…

Q: do strawberry and raspberry fall under the category of eudicots

A: The eudicots, also known as eudicotyledons, are a group of flowering plants that are primarily…

Q: Which of the following is true about global vision loss? a.Over 80% of vision loss can be prevented…

A: At least 2.2 billion people worldwide suffer from a near- or distance vision impairment.  Nearly…

Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…

A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…

Q: IPTG (isopropylthiogalactoside) is commonly used to induce protein expression in Lac…

A: IPTG, also known as isopropyl d-1-thiogalactopyranoside, is a molecular biology tool. This substance…

Q: CHOPPY Maleae Gillenieae Kerrieae Exochordeae Sorbarieae Amygdaleae Lyonothamneae Spiraceae…

A: Introduction:- The classification of different organisms is based on the two biological approaches -…

Q: Briefly explain the alternative communication systems in early childhood education or classroom.…

A: Children who have trouble hearing or speaking benefit from alternative communication. Children that…

Q: Which statement is true of viral replication?  A)  virus attaches to a specific receptor site on…

A: A virus is a non-cellular, infectious entity that is minuscule in size and can survive by surviving…

Q: How to measure the muscle strength and muscle mass by using the anthropometric assessment

A: Anthropometric measurements provides the quantitative measurements of the body. This assess the…

Q: A patient that received a knee replacement implant is experiencing high fever, inflammation, and…

A: Inflammation is the body's response to injury, irritation or infection. It involves the release of…

Q: expected frequency

A: Hardy-Weinberg equilibrium: It is a principle which states that the genetic variation in a…

Q: Imagine you are planning to visit a family member who is a nursing home resident. The nursing home…

A: In that case we have to test RT-PCR test

Q: 7. In the documentary titled: "Peter Singer: Dangerous Mind" Dr. Singer presented his position with…

A: The answer of this question is option D: Disabled infants don't have any right to life.

Q: 4. Explain the connection between hepatitis D and B. How these diseases are related.

A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…

Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…

A: The size of the island and its position is very much crucial for species richness. There are several…

Q: 1. Why are some microorganisms capable of utilizing certain carbohydrates and some are not?

A: Depending on the unique enzymes of each bacterium, different energy sources are used by bacteria in…

Q: 4.08 H H ↓ 1.02 ↓ | 2.54 11.02↑ E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H…

A: Endonuclease HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic…

Q: 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using…

A: While studying the global pandemic it is assumed that approximately 300,000 children or more might…

Q: In this activity, you will: 1. Observe life forms other than those you studied from Grades 3 through…

A: This activity is about different types of living beings. Living beings carry out various life…

Q: Rickets is the result of: a lack of vitamin D. high UV exposure. a lack of melanin. severe air…

A: The disease is a state which is deviated from healthy state. The health is defined as the…

Q: The Hardy-Weinberg Principle states that gene frequencies in a population are overall conserved.…

A: The frequencies for a system with three alleles—p, q, and r—can be written as follows:…

Q: Can nanomaterials in smart packaging be used to monitor food fermentation?  subject:

A: Nanomaterials can be used as a food additive or nutritional carrier in food packaging, as well as a…

Q: About 70 percent of all Caucasians can taste the chemical phenylthiocarbamide, and the remainder…

A: There is present single gene in the population. These are T and t. TT and Tt encode taster…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctqctc 61 tcggcggccc tggccctgac…

A:

Q: The figure below shows differential methylation patterns for various genes in samples of 2 embryonic…

A: The process by which methyl groups are added to the DNA sequences is called DNA methylation.…

Q: The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of…

A: Drosophila is a fruit fly, which has genetically 4 pairs of chromosomes in its genome. It is the…