Phenylketonuria (PKU) is caused by the absence of the enzyme phenylalanine hydroxylase, which catalyzes the first step of the pathway that breaks down the amino acid phenylalanine, a common component of dietary protein. Explain how environmental intervention is commonly practiced to prevent the development of this human autosomal recessive condition.
Q: E. coli has a doubling time of 0.345 hours at 37 0C. Starting with 1 milligram of cells, assuming a…
A: Microorganisms have complex interactions with their environment and with other microorganisms, and…
Q: The pattern of most hormone secretion is described as? Please explain
A: The glands, like the pineal gland or the paracrine gland, produces hormones, which are signalling…
Q: Which of the following statements BEST describes how the DNA interacts with the nucleosome? Selected…
A: Eukaryotic DNA remain associated with histone proteins which is a positively charged basic amino…
Q: Using the antibody panel provided, answer the following questions Are there antibodies that cannot…
A: This question focuses on the results of an antibody panel for a patient and asks about the…
Q: Use the following diagrams to compare ATP and NAD* molecules. 0 0-P-O-P-0-P-0-CH₂ 0 0 three…
A:
Q: Chapter 3 Cardiorespiratory Endurance: Assessment and Prescription The following are the videos you…
A: Introduction Cardiorespiratory endurance, also known as cardiovascular endurance, refers to the…
Q: What is the protein recommendation by age? Gender?
A: Protein is an important part of a healthy diet and its recommended intake varies according to a…
Q: What occurs during phosphorylation? O a) A phosphate group attaches to another organic molecule. Ob)…
A: Introduction : Protein phosphorylation is required for protein function. Since this causes diverse…
Q: As inspired air moves through the conducting airways, the temperature of the gas becomes that of the…
A: Inspired air contains nitrogen, oxygen and carbon dioxide as the main components. As this air moves…
Q: Using my chart can you help me answer this question? The tests we were qualitative; they allowed us…
A: The starch test is a method to determine the presence or absence of starch in a sample using iodine…
Q: What is the detailed physiology of Sulfur Oxidizing Organisms (e.g. bacteria) in terms of…
A: Sulfur is a chemical element required by almost all living entities. It can be present in organic…
Q: What is the purpose of the oil when using oil immersion objective? 2. Why should the oil…
A: A microscope is a device that magnifies small objects. Some microscopes can even be used to view an…
Q: Give an example of how invasive species have taught about the importance of predators or herbivores.…
A: An invasive species refers to a non-native species, including plants, animals, and microorganisms,…
Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna
A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…
Q: What gas is emitted during the fermentation process of yeast?
A: Fermentation is a metabolic process in which microorganisms, such as yeast, break down…
Q: Define altruism, and indicate how this concept relates to moral de
A: Altruism is one of the behaviour which is studied in ethology, the science of animal behaviour.…
Q: How is this diagram best explained? Chemical potential energy reactants products Reaction progress…
A: Introduction Activation energy is the minimum amount of energy required for a chemical reaction to…
Q: A. Organism that causes disease B. Larger in children than adults, this organ is the site of T cell…
A: The defense system in the human body is known as the "immune system", it comprises various cells and…
Q: Many cells reduce testosterone to a steroid that has a higher affinity to the androgen receptor.…
A: DHT is a more potent androgen than testosterone and is responsible for the development of male…
Q: Which meiotic division(s) reduce(s) chromosome number (i.e., meiosis I, meiosis II, or both)?…
A: In sexually reproducing animals, a specific type of cell division known as meiosis creates haploid…
Q: Viruses are living or not living - that is the question!”
A: Microbes are the organisms that cannot be seen as such through naked eyes but require microscope for…
Q: 16) You are a microbiologist who has just discovered a brand-new virus: Virus A. The DNA sequence of…
A: DNA ( Deoxyribonucleic acid) is two stranded , helical , ladder like structure which act as genetic…
Q: Blood of a 12 -year old boy presents low concentration of uric acid and accumulation of xanthine and…
A: Introduction :- Xanthine is a naturally occurring compound that is a type of purine, which is a…
Q: Using the AACT method, calculate and compare the relative quantity value for your gene of interest…
A: The AACT method (also known as the 2^-ΔΔCt method) is a commonly used quantitative real-time…
Q: Which of the following statements is true? Fast glycolytic fibers have a small diameter.…
A: Fast glycolytic Fibers: Fast glycolytic fibers, also known as type IIb fibers, are a type of muscle…
Q: Explain Avery-MacLeod-McCarty experiment (the 1940's) with capsule forming bacteria (smooth) and…
A: Bacteria are single-celled microorganisms found in all environments on Earth, including soil, water,…
Q: Chimpanzees, gorillas, and orangutans all have 48 chromosomes, whereas humans have 46. Human…
A: Introduction Chromosomes are thread-like structures made of DNA and protein that carry the genetic…
Q: Many digestive enzymes are synthesized in the pancreas and released into the duodenum. Why do…
A: The process of breaking down huge food particles into more easily absorbed nutrients for cellular…
Q: Did you achieve isolation using the quadrant streak? If so, in which streak (1, 2, 3, or 4) did it…
A: In microbiology, a streak plate is a culture plate on which the bacteria are streaked which allows…
Q: Take a position for or against the fluoridation of water and provide 3 points to back up your…
A: The addition of fluoride in water is solely responsible for many diseases. The U.S Food and Drug…
Q: Is triose phosphate the simplest monosaccharide? How is it synthesized in plants
A: Since they cannot be hydrolyzed into smaller carbohydrates, monosaccharides are the most basic types…
Q: Thoughts on GMOs? Should it be allowed? Should they be labeled? Try to give at least one…
A: My thoughts on GMOs are that they can be a valuable and important tool for providing food to more…
Q: What is the daily protein requirement?
A: The daily protein requirement varies depending on factors such as age, sex, weight, activity level,…
Q: In your own words compare and contrast sexual reproduction of most animals and plants vs. asexual…
A: Most of the higher organisms reproduce sexually while as most of the lower organisms reproduce…
Q: Discuss the advantages and disadvantages of different methods for delivering hormones.
A: Hormones are chemical messengers that regulate various bodily functions, and they can be delivered…
Q: Phenylketonuria (PKU) is caused by the absence of the enzyme phenylalanine hydroxylase, which…
A: Phenylketonuria (PKU) : Phenylketonuria (PKU) is an inherited metabolic disorder that affects the…
Q: written answer with explanation and conclusion A methodology that measures the intensity of…
A: All these techniques mentioned below are designed to measure the concentration of given substance…
Q: Identify the epithelial tissue shown.
A: Introduction - Form continuous sheets (fit like tiles)Apical SurfaceAll epithelial cells have a top…
Q: The following eukaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…
A: mRNA: Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA…
Q: 4. Given a diploid chromosome numbe 4. Draw below a gametophyte cell in the midst of 1) Anaphase of…
A: Mitosis is essential in embryonic development because it allows a single-cell zygote to grow into an…
Q: Can you explain what is nucleotide selectivity in polymerase
A: One of the structural elements, or building blocks, of DNA and RNA is the nucleotide. A nucleotide…
Q: One of the most surprising findings from randomized controlled trials on vitamin D is that: a.…
A: Vitamin D is a fat-soluble vitamin that plays a crucial role in several important functions in the…
Q: Question 24. The temperature of stringent washing (Tw) is calculated using the Tm (melting…
A: Stringency is used to define the degree of similarity between the probe and the nucleic acid bound…
Q: Drag the X and Y chromosomes to the drawings below, lining them up properly for metaphase I and…
A: Meiosis is the cell division procedure that results in the formation of sperm and egg cells,…
Q: which individual has the shortest telomeres?
A: Telomeres are repeating DNA regions found at the ends of chromosomes that serve as protective caps…
Q: Provide detailed blood cell diagram of how microsytic is developed. Provide detailed blood cell…
A: Small, frequently hypochromic red blood cells are considered a sign of microcytic anemia, which is…
Q: Discuss the use of anti-idiotypic antibodies to mimic hormone action.
A: Anti-idiotypic antibodies are a type of antibody that can be used to mimic the action of hormones.…
Q: To what extent do Class and Structure vary in their practical application?
A: Organisms are incredibly complex systems with various behaviors, functions, and interactions. By…
Q: what would happen if wingless were expressed throughout the embryo
A: Embryo: An embryo is the early stage of development of a multicellular organism, starting from the…
Q: latch the following examples with the levels of protein structures. 4 1 2 3 > > The overall fold of…
A: All the structures given below show different levels of protein structure such as primary,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1a) Explain how amino acids in casein could reach the liver, starting fromthe moment when the person takes a bite of pastry cream pie. b) Congenital lactase deficiency is a type of lactose intolerance that occursin infants. It is inherited in an autosomal recessive pattern. Calculate thechance of congenital lactose intolerance in a child whose parents are both carriersfor the disorder, showing fully how you reached your answer.Retinitis pigmentosa, a group of related eye disorders that cause progressive vision loss, is due to an autosomal dominant allele. Tay-Sachs disease, on the other hand, is due to a defective gene with incomplete dominance. A mutation in the recessive HEXA gene prevents the synthesis of the lysosome enzyme beta-hexosaminidase A. This mutation prevents the breakdown of GM2 ganglioside, thus increasing to a toxic level that damages neurons. Luisa is a carrier of the allele for Tay-Sachs but has no sign of any eye disorder in her family. She married Gerard whose mother was afflicted with retinitis pigmentosa, unlike his father. Neither of his parents has any history of Tay-Sachs disease. What are the genotypes of Luisa and Gerard? Luisa:______________________________Gerard:_____________________________Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that normally metabolizes the amino acid phenylalanine; when this enzyme is defective, high levels of phenylalanine cause brain damage, in the past, most children with PKU became intellectually disabled. Fortunately, intellectual disability can be prevented in these children by carefully controlling the amount of phenylalanine in the diet. The diet is usually applied during childhood when the brain development is taking place. As a result of this treatment, many people with PKU now reach reproductive age. Children born to women with PKU (who are no longer on a phenylalanine-restricted diet) frequently have low birth weight, developmental abnormalities, and intellectual disabilities. However, children of men with PKU do not have these problems. Describe the results depicted in Fg1. and us it to provide an explanation for these observations What type of genetic effect is…
- Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that normally metabolizes the amino acid phenylalanine; when this enzyme is defective, high levels of phenylalanine cause brain damage, in the past, most children with PKU became intellectually disabled. Fortunately, intellectual disability can be prevented in these children by carefully controlling the amount of phenylalanine in the diet. The diet is usually applied during childhood when the brain development is taking place. As a result of this treatment, many people with PKU now reach reproductive age. Children born to women with PKU (who are no longer on a phenylalanine-restricted diet) frequently have low birth weight, developmental abnormalities, and intellectual disabilities. However, children of men with PKU do not have these problems. QUESTION: Describe the results depicted in Fig Use the first question to provide an explanation for these observations. What type of genetic effect…Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that normally metabolizes the amino acid phenylalanine; when this enzyme is defective, high levels of phenylalanine cause brain damage. In the past, most children with PKU became intellectually disabled. Fortunately, intellectual disability can be prevented in these children by carefully controlling the amount of phenylalanine in the diet. The diet is usually applied during childhood, when brain development is taking place. As a result of this treatment, many people with PKU now reach reproductive age. Children born to women with PKU (who are no longer on a phenylalanine-restricted diet) frequently have low birth weight, developmental abnormalities, and intellectual disabilities. However, children of men with PKU do not have these problems. a. Provide an explanation for these observations. b. What type of genetic effect is this? Explain your reasoning.Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that normally metabolizes the amino acid phenylalanine; when this enzyme is defective, high levels of phenylalanine cause brain damage. In the past, most children with PKU became intellectually disabled. Fortunately, intellectual disability can be prevented in these children by carefully controlling the amount of phenylalanine in the diet. The diet is usually applied during childhood, when brain development is taking place. As a result of this treatment, many people with PKU now reach reproductive age. Children born to women with PKU (who are no longer on a phenylalanine-restricted diet) frequently have low birth weight, developmental abnormalities, and intellectual disabilities. However, children of men with PKU do not have these problems. Q. Provide an explanation for these observations.
- Achondroplasia is an autosomal dominant disorder characterized by disproportionate short stature: the legs and arms of people with achondroplasia are short compared with the head and trunk. The disorder is due to a base substitution in the gene, located on the short arm of chromosome 4, that encodes fibroblast growth factor receptor 3 (FGFR3). Although achondroplasia is clearly inherited as an autosomal dominant trait, more than 80% of the people who have achondroplasia are born to parents with normal stature. This high percentage indicates that most cases are caused by newly arising mutations; these cases (not inherited from an affected parent) are referred to as sporadic. Studies have demonstrated that sporadic cases of achondroplasia are almost always caused by mutations inherited from the father (paternal mutations). In addition, the occurrence of achondroplasia is higher among the children of older fathers; approximately 50% of children with achondroplasia are born to fathers…Pancreatic cancer is clearly inherited as an autosomal dominant trait in the family illustrated in Figure 23.1. Yet most cases of pancreatic cancer are sporadic, appearing as isolated cases in families with no obvious inheritance. How can a trait be strongly inherited in one family and not inherited in another?Phenylketonuria (PKU) is caused by the absence of the enzyme phenylalanine hydroxylase, which catalyzes the first step of the pathway that breaks down the amino acid phenylalanine, a common component of dietary protein. Explain how environmental intervention is commonly practiced to prevent the development of this human autosomal recessive condition.
- We often speak of diseases such as phenylketonuria (PKU) andachondroplasia as having a genetic basis. Explain whether the followingstatements are accurate with regard to the genetic basis ofany human disease (not just PKU and achondroplasia).A. An individual must inherit two copies of a mutant allele to havedisease symptoms.B. A genetic predisposition means that an individual has inheritedone or more alleles that make it more likely that she or he willdevelop disease symptoms than other individuals in a populationwill.C. A genetic predisposition to develop a disease may be passedfrom parents to offspring.D. The genetic basis for a disease is always more important thanthe environment.Maple syrup urine disease (MSUD) is an autosomal recessive metabolic disorder that presents in newborns, typically within the first 48 hours after birth. As the name suggests, a key indicator of the disease is the presence of a sweet odor in the urine that smells like maple syrup. Left untreated, MSUD can result in failure of central neurological function and the respiratory system and can be fatal. MSUD is caused by mutations in components of the branched-chain alpha-keto acid dehydrogenase complex (BCKDC). These mutations result in the inability for cells to break down branched-chain amino acids (BCAAs). BCAAs and their byproducts accumulate and are excreted in the urine, giving rise to the maple syrup scent. QUESTIONS: Draw the structures of the three branched-chain amino acids (BCAA). Draw the structures of the three BCAA products released by functional BCKDC. Indicate the original amino acid.Albinism is characterized by the lack of a dark pigment called melanin in the hair, skin and eyes. Albinism is caused by the absence of an functioning enzyme called thyrosinase, which is necessary for the synthesis of melanin. Given this bit of information, what can you assume about the heredity pattern of this trait? A) It is caused by a recessive allele of the gene coding for thyrosinase. B) It is caused by a dominant allele of the gene coding for melanin. C) It is caused by a dominant allele of the gene coding for thyrosinase. D) It is caused by a recessive allele of the gene coding for melanin. E) There is not enough information here to tell