O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) No Lactose Lactose Genotype TP OcZ Y/I P O*ZY* I'POCZ Y*/I P* O©Z*Y• PP O'Z'Y/I P'O Z'Y* PP O Z Y*/IIP'OZ'Y* rp O°Z*Y/I P*O*ZY* IPO'Z'Y*/I* P*O©Z*Y• I'P'O*ZY*/I P*OʻZ*Y° Lactose

O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) No Lactose Lactose Genotype TP OcZ Y/I P OZY I'POCZ Y/I P O©ZY• PP O'Z'Y/I P'O Z'Y PP O Z Y/IIP'OZ'Y rp O°ZY/I POZY IPO'Z'Y/I PO©ZY• I'P'OZY/I POʻZY° Lactose

Name: O The lac operon in E.coli encodes enzymes necessary for the breakdow
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. Foreach enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made whenthere is no lactose or when there is lactose.B-galactosidase (lac Z)No LactosePer

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Under what conditions will the following partial diploid strain of E. coli convert chorismate to tryptophan (assume trp mutants function similarly to lac mutants)? trpR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ trpR trpP trpO° trpE trpD trpC trpB trpA ect the one BEST answer (2 oints! O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are low
A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. OF POZY Ort Ptot Z¹ Yt Ort p²o+z¹Y+ Orpt ot zty
1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of lactose B-galactosidase permease B-galactosidase permease I*P*O*Z*Y* Mututed ISP+O*ZY* I'P*O°Z*Y* I*P*O°ZY
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Qutstion T Lacl gene product is or does all of the following except A regulates expression of Lac ZYA B is a diffusible, trans-acting regulator. is a positive regulator of Lac ZYA D is a negative regulator of Lac ZYA
The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinate
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
What does RNA polymerase transcribe from the Lac Y gene on the lac operon? O beta-galactosidase O Thiogalactoside O Transacetylase O Lactose permease O RNA polymerase
In the trp operon, tryptophan itself serves as the effector for the trp repressor which causes it to release from the operator and allow the gene to be transcribed. O True O False
I have this strain of e coli. Is P+ o+ Z+ Y+ / I- P+ oC Z- Y+ Will beta-galactosidase and permease be expressed? If they are will they be inducible or constitutive?
that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification Post-translational modification Reactive (R) group Trans-acting C Operon Nuclear localizationsignal Double-stranded RIA Shine-Dalgarno sequence Kozak sequence E site on ribosome Ps p riboeE8R3) A site on ribosome Constitutive F Allosteric transition Inducer ll ol g Repressor T G H. Nonsense codon Frameshift mutation W Chaperones Found upstream of AUG codons in bacteria, this binds the 3' end of the 16S rRNA of the 30S ribosomal subunit Addition of chemical groups to amino acids in a polypeptide Hidigel elnw eesel Poly (A) polymerase enzyme uses ATP as substrate to add a string of A nucleotides on to the 3'-OH of MRNA Jeiheg 1ot eninoaso uoy nielgxe 10 anoitamusas Tuoy elsta otehgo1qqs eedW 4 Is produced when both strands of DNA encoding a gene are transcribed simultaneously A class of proteins that arrest incorrectly or incompletely folded proteins 6. Occurs when allolactose binds Lacl protein causing…
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-