Q4.4. Which statement below is TRUE about neurotransmitters?The entry of neurotransmitter through K* channels into neurons triggers the rising phase of the action potential.Neurotransmitters are released from muscle cells to activate motor neurons in the presence of botulinum toxin.O Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.O All of the above.

Answered: Image /qna-images/answer/3aee7f79-d9f8-4406-8d3e-c1365a21580c.jpg

Answered: Neurotransmitters are released from a…

Science

Biology

Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter12: The Nervous System And Nervous Tissue

Section: Chapter Questions

Problem 8ILQ: Watch this video (http://openstaxcollege.org/l/neurotrans) to learn about the release of a...

See similar textbooks

Related questions

Q: Why are parasitic infections of nematodes still common despite our understanding of their biology?…

A: The parasitic can reside in the human body's small intestine. They reproduce by laying eggs and…

Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…

A: Rheumatic fever:A illness that can develop as a result of strep throat or scarlet fever that has…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…

A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…

Q: Describe the difference between the nerve and muscle in response to increasing stimulus voltage.

A: Introduction A nerve is a cable-like structure within the body composed of neurons that uses…

Q: Organisms growing anaerobically cannot perform glycolysis for long without reducing the pyruvate…

Q: Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion…

Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer

A: INTRODUCTION Answer to the question 44 is given below.

Q: The divisions of the nervous system can be divided into the central and peripheral nervous system.…

A: The type of representation of nervous system is most akin to the conceptual hierarchy.

Q: Bat/Hedgehog/??

A: MERS is also called Middle East respiratory syndrome. It is a contagious, sometimes fatal…

Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…

A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…

Q: Construct a comparative matrix on different sterilization methods.

A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…

Q: Stimulation of D1 Medium Spiny Neurons in the Striatum causes of the Globus Pallidus and subsequent…

A: The basal ganglia are involved in action selection. It is a proven fact that a direct pathway leads…

Q: Referring to Figure 17-26, draw the product if breaks occurred within genes A and B

A: An inversion is a chromosomal rearrangement where a portion of a chromosome is flipped end-to-end.…

Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…

A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…

Q: If you examined an en-GFP transgenic fly, where would you expect to see GFP expression? O In the…

A: *GFP can be introduced to animals by using transgenic techniques will be maintained in their genome…

Q: 13. Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А…

A: A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm.…

Q: A 3-point test cross produces the following numbers of offspring: What gene is in between the other…

A: Genes are DNA sequences of nucleotides that code for RNA, and RNA codes for a protein. In the case…

Q: What are the species of aerobic bacteria which can be found in chronic wound?

A: Introduction A wound is an injury that occurs quickly and involves lacerated or punctured skin (open…

Q: 7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced…

A: Solution :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the…

Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…

A: The tRNA is responsible for transferring amino acids at the site of translation or protein…

Q: What is psedupodia

A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.

Q: state why simplicity and speed are top priorities in selecting DNA isolation method

A: * Deoxyribonucleic acid that is isolation is the extraction process of DNA from other sources. * The…

Q: Q.6.What Is Typhoid? List out the symptoms of Тyphoid?

A: Typhoid fever is an infectious disease caused by the bacteria Salmonella typhi, also known as S.…

Q: Like nucleotides, amino acids have directionality in their back bone. While nucleic acids are…

A: Central dogma The process of translation of DNA into gene products is called the central dogma. It…

Q: A BIO101 student says, "Dr. Lopes spend all our time talking about DNA, but that's silly because DNA…

A: DNA and RNA are the genetic material. These carry the information from one generation to another.…

Q: Recent - English (en) - 23/4/2022 l a 12:00 e ial الاجابة تكون على شكل نص كتابي فقط و يمنع تحميل…

A: A BUN test is a blood test most commonly used to evaluate kidney function. It's often done along…

Q: explain what is similar and what is different from the bacteriophages of covid-19

A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: Homeostasis is extremely important for organism existence. It is frequently seen as a resistance to…

Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…

A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…

Q: The number of Microorganism A was exposed to a constant temperature of 117 C surviving spores of the…

A: D value is decimal reduction time and is described as time needed at a particular temperature for…

Q: The elements that present in Protoplasm

A: A cell's protoplasm, cytoplasm, and nucleus are all examples of protoplasm. The phrase was first…

Q: ___ refers to the collection of all alleles across all gene loci in a population. a) Genetic drift…

A: Introduction :- An allele is a variant form of a gene. It is found on a certain chromosome at a…

Q: Identify the stages of mitotic division observed in one of SimpLENI's slides labeled as A, B, and C.…

A: The stage labeled as A is Telophase. Telophase is the 4th stage of mitosis where the sister…

Q: Match the force for evolution with its description, definition or example. This force typically…

A: Introduction Evolution is the process of a species' features changing over numerous generations…

Q: Thomas, a 62-year-old man, is experiencing pain in his left chest and left arm. When he reaches the…

A: Introduction A heart attack occurs when blood flow to a part of your heart stops, one or more of…

Q: Question 23) For these three situations below, describe whether there are changes in humoral,…

A: MC4 receptors reduce the food intake while elevating energy utilization . Action of this receptor…

Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…

A: RNA polymerase is an enzyme found in the nucleoplasm of nucleus. It is involved in the…

Q: Defining occupational health and safety and its importance in the work environment.

A: occupational health deals with all aspects of health and safety in the workplace and has a strong…

Q: Match the following structures with their functions a. blood clotting b. matrix of blood and…

A: Human body is a complex machine required in many processes to function efficiently. To keep these…

Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A…

A: The replication is the process of producing double standard DNA molecule from the parental double…

Q: You treat cells with 2,4 dinitrophenol (DNP). This compound creates a temporary channel in the inner…

A: DNP is a compound that is toxic and highly flammable/explosive. It uncouples oxidative…

Q: 1. What is a casque? Which members of Casuariiformes have one, and what is though to be its…

Q: A man infected with a viral respiratory infection sneezes and releases tiny droplets containing…

A: INTRODUCTION Virus It is a microscopic infectious agent contain DNA or RNA as their genetic material…

Q: Discuss the strengths and weakness of the traditional Innovative health financing mechanisms

A: The purpose of health financing is to make funding available, as well as to set the right financial…

Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…

A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…

Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…

A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…

Q: All of the following are muscles that control movements of the eyeball EXCEPT the O A orbicularis…

A: 1) movement of the eyeball is controlled by six extraocular muscles and these are the following:…

Q: FIGURE 10-3 Label this section of a finger with the appropriate terms on the lines provided and on…

A: Introduction The nail is made up of highly specialised epithelial cells and is platelike,…

Q: A potato cube is placed in a solution. The volume of the potato increases. which statement below is…

A: Osmosis is a process of flow of solvent molecules from lower concentration to higher concentration…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Q4.4. Which statement below is TRUE about neurotransmitters?
The entry of neurotransmitter through K* channels into neurons triggers the rising phase of the action potential.
Neurotransmitters are released from muscle cells to activate motor neurons in the presence of botulinum toxin.
O Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.
O All of the above.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Q4.7. Why does Na* enter the cell during the action potential? Because the Na* channels are open and only let Na* move from outside to inside Because the action potential pulls positive ions into the cell while Na* and K* channels are open Because Na channels are open and allow Na* ions to move down the length of the axon to produce neurotransmitter at the axon terminal Because Na" channels are open and there is a higher concentration of Na outside of the neuron than inside
Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion channels near the stimulus site to transmit information? Because without the action potential, changes in Vm at the stimulus site might not reach the axon terminal Because without the action potential, the neuron would not depolarize Because action potentials help the body keep ion concentrations at appropriate levels Because without the action potential, the neuron would not return to resting potential O O
Q5.3. After the rising phase, which ion channel is responsible for action potential returning to its resting Vm, and why? Na+ channels, because positive Na* ions are at higher concentration outside the axon than inside, and so they enter the axon and raise V m Na* channels, because positive Na* ions are at higher concentration inside the axon than outside, and so they leave the axon and raise Im K* channels, because positive K* ions are at higher concentration outside the axon than inside, and so they enter the axon and raise Vm K+ channels, because positive K* ions are at higher concentration inside the axon than outside, and so they leave the axon and lower Vm Submit
Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action potential? The voltage-gated Na* channels are open the entire time that the neuron is depolarized (when Vm is above resting potential). The voltage-gated Na* channels open after the voltage-gated K* channels. The voltage-gated Na* channels open to restore Vm to the resting potential after the action potential peak. The voltage-gated Na* channels are open when Vm is rapidly increasing during the action potential.
Q5.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion channels near the stimulus site to transmit information? Because, without the action potential, changes in Vm at the stimulus site might not reach the axon terminal Because without the action potential, the neuron would not depolarize Because action potentials help the body keep ion concentrations at appropriate levels Because, without the action potential, the neuron would not return to resting potential Submit
Q5.6. If calcium ions, each of which has a charge of +2 (Ca²+), moved INTO a neuron, and no other ions were moving, what would be TRUE? The area outside the neuron would be become more positively charged. The concentration of Ca²+ inside the cell would decrease. The neuron would become more negative. The neuron would become more positive. Submit
Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action potential? The voltage-gated Na* channels are open the entire time that the neuron is depolarized (when V, is above resting potential). m The voltage-gated Na* channels open after the voltage-gated K* channels. The voltage-gated Na* channels open to restore Vm to the resting potential after the action potential peak. The voltage-gated Na* channels are open when Vm is rapidly increasing during the action potential.
Q4.6. If calcium ions, each of which has a charge of +2 (Ca2*), moved OUT OF a neuron, and no other ions were moving, what would be TRUE? The area outside the neuron would be become more negatively charged. The concentration of Ca2* inside the cell would increase. The neuron would become more negative. The neuron would become more positive.
D Question 18 Which of the following statements describes the signal amplification that results from activation of the G-protein coupled receptor? Fragmentation of the G-protein leads to an increase in entropy O The binding of a ligand to the receptor increases the chances of the receptor binding a G-protein The binding of a G-protein to the receptor increases the chances of it exchanging GDP for GTP O The ligand is bound to the receptor sufficiently long such that the receptor can fragment several G-proteins
by Portal C oads X portal.bartleby.com Chapter 16 Special.... QAnatomy Chapter 1... 70% 14 min 08 secs. 14/20 > >> Which of the following statements is TRUE about temporal summation? The postsynaptic cells potential is a combination of two EPSPS arriving at a synapse at rapid succession. Two synapses on different regions of a cell are stimulated at the same time. A synapse is stimulated a second time after the effect of a first stimulus at the synapse has been terminated. IPSPS, but not EPSPS are combined. Next compan + f2 f3 f fr
Which of the following is incorrect about pathways activated by G-proteincoupled receptors? a. The extracellular signaling molecule is the first messenger. b. When activated, plasma membrane-bound G protein canswitch on an effector. c. Second messengers enter the nucleus. d. ATP converts to cAMP to activate protein kinases. e. Protein kinases phosphorylate molecules to change cellularactivity.
Q5. Diazepam is a drug that stimulates the activity of GABA receptors in the brain. If a person was having an epileptic seizure, how would diazepam affect the seizure? Q6. During a surgical procedure, an anesthesiologist administers to the patient an inhaled anesthetic agent that opens Cl- channels in the postsynaptic membranes of neurons of the brain. Explain why this would put the patient “to sleep” for the duration of the surgical procedure. Q7. Jack places his foot on a piece of broken glass. He immediately lifts his leg away from the glass without losing his balance. What reflex response has occurred? How does he manage to maintain his balance? Q8. Which cranial nerves would be affected by a drug that stimulates the parasympathetic nervous system? Predict potential adverse effects that one might experience. Q9. Mr. Putuu has been diagnosed with Horner syndrome, which is caused by dysfunction of the sympathetic neurons in the superior cervical ganglion that innervate…