NAME CENTRAL DOGMA A c 6 A I A c G. c I A A CT EMPLATE RNA id chein M RNA) takes Difference bl DNA aud RNA is the process where DNA is copied ciuto M RNA. Sccurs at stranded is the process where RNA is uoed to make protuis A. sugar
Q: Enzyme(s) in DNA Pol III involved in DNA replication include DNA E (a) DNA Q (ɛ) HolE all of these
A: The process by which DNA strand is synthesized from a another DNA strand is known as DNA replication…
Q: A strand of DNA has the base sequence of AGCCAT (written in the 5' to 3' direction). What is the…
A: Genetic code, the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)…
Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…
A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…
Q: Stacking of bases in B form DNA 1. Is mostly interstrand. 2. Occurs due to Van der Vaals…
A: Base stacking is an arrangement of bases in the 3D structure of DNA.
Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…
A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…
Q: A genetic sequence that can move from one location to an-other within a cell is known as a:(a)…
A: The genome comprises of the coding and non-coding sequences, in which the coding sequences are…
Q: ge Ho onis pa re "hanging down
A: The transcription factor of the RNA polymerase two has the following functions: TFIID:…
Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…
A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…
Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…
A: There are different types of mutations which involves- Deletion mutation, insertion mutation,…
Q: DNA Whic corres A. AC B. UG. В. C. UGA D. ACU
A: The process of producing proteins from DNA - deoxyribonucleic acid - sequence involves two major…
Q: OLD DNA NEW DNA mRNA PROTEIN STRAND STRAND NAME REPLICATION TRANSCRIPTION TRANSLATION CGT AGC TGC 1…
A: DNA ( Deoxyribonucleic acid) is a two stranded , helical structure present inside the nucleus of the…
Q: ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown…
A: DNA replication is a process in which DNA itself form DNA . It is two stranded , ladder like and…
Q: OLD STRAND NEW OF DNA REPLICATION TCG ATT ACT 1 ACT AGT ACT 4 AGG ACC TAC CTG TAG 7 AGG STRAND OF…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG|| MRNA: amino acids:
A: As per our company guideline we are supposed to answer only first queation . So kindly repost other…
Q: O A. DNA renaturation takes longer than denaturation. ОВ. DNA renaturation and denaturation take…
A: DNA stands for deoxyribonucleic acid,which is a molecule that contains the instructions an organism…
Q: Choose the false statement: O Penicillin is a ß lactam which inhibits bacterial growth by inhibiting…
A: An antimicrobial is an agent that kills microorganisms or stops their growth. In this questions, we…
Q: oth DNA (D) and RNA a. What is the KM b. What is the KM C. What is the Vm d. What is the Vm e. On…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase
A: Transcription: Formation of mRNA from DNA with the help of enzyme RNA polymerase.
Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…
A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…
Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…
A:
Q: Send A PEETRAS O
A: Transcription is the process of formation of RNA from the DNA.The transcription process takes place…
Q: OTPDI Ə g TITM d. The viral DNA will be rodioactive e. The viral proteins will be radioactive. 48.…
A: Introduction :- Transfer RNA is an adapter molecule made up of RNA with a length of 76 to 90…
Q: then he has to chop it up Dr. A. Zion wants to study the flight gene of birds. In order to study the…
A: Information Given: Zion wants to analyse DNA sample of a bird from it's flight gene 1st blank: First…
Q: Which is the best definition of a genetic mutation? An error in a code. OA mistake during copying.…
A: A Mutation happens when a DNA gene is harmed or changed so as to adjust the hereditary message…
Q: RNA polymerase synthesis in a 5-3 direction O Gene is switched ON O Gene is switched OFF O Does NOT…
A: Transcription is the process of synthesis of an RNA molecule from the template strand of the DNA…
Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)
A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…
Q: Acyclovir is best said to be a / an: Select one: O a. nucleoside Ob. nuclear base C. MRNA drug Od…
A: Acyclovir : Acyclovir is an antiviral medicine generally used for the treatment of viral diseases.…
Q: A Original DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TOT CTO TAT Complementary DNA B. Make lenteal…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Q: Yu raach aitantin a ab tht studies mucleic acids. Your advisor gave you four tubes for analysis.…
A: Each organism have a genetic meterial by which they regulate, inherited and constant their…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…
A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…
Q: How many nucleotides are in 13 MRNA codons? Lütfen birini seçin: O a. 13 O b. 26 O c. 39 O d. 78
A:
Q: Define the following terms:a. DNAb. RNAc. double helixd. genomee. transcription
A: DNA : DNA is deoxyribonucleic acid. It is a long molecule which is made up of nucleotides .…
Q: is a single stranded RNA molecule held together by hydrog bonds. Answer: MRNA Which of these DNA…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…
A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…
Q: CODES FOR CRACKING ATG AAG TCA GCT ATT TTA AC DNA CODE 1 CRACKED CODE WHAT IS IT? WHAT DOES IT DO?…
A: Messenger RNA is synthesized by the process called transcription. In this process RNA polymerase…
Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I. A…
A: The replication is the process of producing double standard DNA molecule from the parental double…
Q: Define the following terms:a. RFCb. DNA glycosylasec. apurinic sited. apyrimidinic sitee. mismatch…
A: Introduction:
Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…
A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…
Q: PER product (Hbp 2 or Ap D) Puri Fied DNAS PETR gest Digested DNAS Ligate Plate e.cob HpD Transfurm…
A: Digestion of any DNA occurs by the exonucleases or endonucleases. The DNA ligases act as the…
Q: 25. An RNA chain being synthesized grows in the direction. a. 5' to 3' Ob. 3' to 5' c. either…
A: Transcription is the process in which a gene's DNA sequence is copied to make an RNA molecule. The…
Q: s' ATG GTA CTC CAG ACT TGA 3' Transcribe the DNA strand. (Use the top strand as your template) NA:…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: ONUS: Why can't RNA viruses use cellular RNA Polymerase to co ecause cellular RNA Polymerases are O…
A: RNA viruses replicate and transcribe their genomes using RNA-dependent RNA polymerases.
Q: Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG
A: The nucleotides are the building blocks of nucleic acids. The nucleotides are formed of a…
Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…
A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…
Q: A scientist isolates the DNA genome from a virus. She attempts to carry out a melting analysis but…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: From the sequence given below, provide the ff: 5 AT G Cс с A С A GT G GA с стт т сс т G A 3' 1. DNA…
A: DNA replication is a process in which DNA itself serves as template for synthesis of DNA . It…
Q: When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a O…
A: The mutation is considered as the process during which nucleotide sequence is altered as a result…
Im having issues please help.
Step by step
Solved in 6 steps
- I ie luncu8k of RNA polymerase. \s a enzyme that is kesponsitae for copying a duyring He jprocess of transeve ip tion (2NA Sapglence DNA Seguence Into an 23. Describe the transcription process that results in synthesis of an RNA molecule.Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypE D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12
- PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
- pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation typeOriginal DNA 3'TAC ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA sequence" above a coding or a template sequence?
- ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 103’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.