Match the metabolic pathway in Figure:17.7 with the reactions listed on 394.
Q: For 100 words. What are the two essential requirements to effectively carry out metabolic work?
A: A metabolic pathway is a linked series of chemical reactions occurring within a cell. In most cases…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: what is the Km for the following enzyme michael menten
A: Michaelis menten constant, Km is the substrate concentration required to produce half maximum…
Q: In the following reaction, what type of reaction is occurring? H2CO3 H* + HCO3
A: Answer 1: Option NEUTRALIZATION is correct. Because : In Biochemistry, the term "carbonic acid" is…
Q: Using the half reactions from the given table, what is the reaction of this reduction-oxidation?
A: Tricarboxylic acid cycle is the final common oxidative pathway for oxidation of carbs, fats and…
Q: List the systematic classification of enzymes according to the Enzyme Commission indication the…
A: Enzymes are classified into six categories according to the type of reaction catalyzed:…
Q: Given the following reaction, identify the class of the enzyme in CH20-PO, 2- CH,OH он O. OH OH OH…
A: Enzymes are biocatalysts that speed the reactions by decreasing the activation energy of the…
Q: Write the enzyme equation for catalase and hydrogen peroxide.
A: An enzyme is a biological catalyst that brings about a reaction where reactants are used up and…
Q: If an enzyme does not alter the equilibrium constant of areaction, how does it speed up the…
A: Enzymes are a kind of protein that serves as a biological catalyst (biocatalysts). Chemical…
Q: Given the following enzyme catalyzed reaction, identify the class and subclass of the enzyme…
A: Depending on the activity and the reaction they catalyse enzymes have 6 different classes…
Q: The Krebs cycle is considered to be an anabolic pathway because some of the reactions are
A: Krebs cycle: Krebs cycle also know as TCA cycle or citric acid cycle is an important part of aerobic…
Q: Classify transaldolase, reaction shown below.
A: Transaldolase is an enzyme that converts ketone sugar into aldose sugar by transferring the carbon…
Q: Write the reaction, occurring in the liver, that causes theoxidation of ethanol. What is the product…
A: The liver is an organ involved in detoxification reactions in the human body.
Q: Complete following table. Coenzyme Related Function of the Provide a reaction that use this coenzyme…
A: A coenzyme is an organic compound that gets bind to the enzyme’s active sites to help in the…
Q: sufficient energy to produce the reaction, supply the lightest missing particle:
A:
Q: In the reaction shown above, Acetaldehyde is being. to form Ethanol. (note the direction of the…
A: The fermentation process is an anaerobic process of generating ATP(adenosine triphosphate); a unit…
Q: H. C=0+NADH + H* H-C-OH + NAD+ CH3 Acetaldehyde CH3 Ethanol 7. Using the reaction above, describe…
A: Fermentation is a type of anaerobic respiration in which Glucose is converted into the ethyl…
Q: NAD+ coenzyme is required for the reaction of ethanol in the liver to ethanal and NADH. Write down…
A: In liver, ethanol is converted into acetaldehyde, an ethanal and a carcinogen by the enzyme alcohol…
Q: Draw the product that is obtained from the reaction of cholesterol with the H2O, H+
A: Cholesterol is the major sterol in animal tissues. It consists of steroid nucleus called…
Q: From the active site diagram below, please indicate the cofactor from the indicated components. HO 4…
A: Cofactors are the non protein molecules that help the enzyme to carry out catalysis. Enzymes without…
Q: For the following reactions, name both the enzyme that catalyzes the reaction and the required…
A: Enzymes are considered as catalytic protein which helps in the catalysis of reaction. The coenzyme…
Q: Consider this chemical equation: Catalase 2H,02 2H,0 + O2 Hydrogen Water Oxygen peroxide What is the…
A: Answer : Catalase
Q: The hydrolysis of ATP to yield AMP and PPi yields_____________ kJ/mol
A: ATP is considered an energy caring molecule that available in the living cell. ATP is made of three…
Q: For the reaction below: CH3CH2I DMF
A: It is an williamson ether synthesis
Q: Which curve represents the spontaneous reaction, and which the nonspontaneous?
A: Gibbs Free energy is the energy that was available to do work under constant temperature and…
Q: Show the complete reaction mechanism (including arrow pushing) for this reaction.
A: Deamination is the process of removal of the amino group from the amino acids as NH3. The liberated…
Q: Write the coupled reaction that would occur spontaneously for the following pairs of molecules under…
A: Citric acid cycle or Krebs Cycle is the cyclic metabolic pathway for the oxidation of various…
Q: Determine whether or not reaction is a redox reaction. For each redox reaction, identify the…
A: Redox reaction is considered as a process, during which one element is must be reduced or oxidized…
Q: List the systematic classification of enzymes according to the Enzyme Commission indicating the…
A: Enzymes are biocatalysts. They speed up a reaction by lowering it's activation energy. Since 1964,…
Q: Consider the following reaction. CH₂-CH-COO-CH₂-C-Coo- он b Which group of enzymes catalyzes this…
A: The six functional classes of enzymes are hydrolases, oxidoreductases, lyases, transferases, ligases…
Q: What amount of catalyst is consumed in the reaction it catalyzes?
A: Enzymes are biological catalysts that help in catalyzing or speeding up biological reactions by…
Q: Use numbers 1 to 5 to identify each carbon atom in the product of this reaction. What coenzyme is…
A: Amino acids have two functional group namely carboxyl and amino group. The above compound is a…
Q: Which type of enzyme (Table) catalyzes the following (given) reactions?
A: Enzymes are the proteins that acts as biocatalyst which binds to the substrate and increasing the…
Q: Name the phase of this reaction and Label the diagram Note fand I are locations AD H
A:
Q: NH2 fofota HO-P- ÓH ОН ОН Using the graphic above, answer the following questions. Is removing…
A: The oxidation reaction is the chemical reaction where the reactants lose either one or a few…
Q: For the following reactions, name both the enzyme that catalyzes the reaction and the required…
A: Carboxylation reactions involve addition of CO2 to a substrate and production of a carboxylic acid…
Q: How is ATP and hydrogen molecules used in the dark reaction? That is, what are these products for…
A: solution photosynthesis literally means synthesis with the help of light. its a vital process where…
Q: Match each reaction description to the type of enzyme that catalyzes the reaction.
A: Those proteins or biological catalysts which help to speed up the chemical reaction are termed…
Q: The enzyme which catalyzes the reaction below belongs to which enzyme classification?
A: There are seven classes of enzymes, they are Oxidoreductases, Transferases, Isomerases, Hydrolases,…
Q: The significance of the ATP molecule shown is best explained by which statement below? *
A: As ATP is used for energy, a phosphate group or two are detached, and either ADP or AMP is produced.…
Q: COO I CH₂ HC-COO HO-CH COO COO™ 1 CH₂ CH₂ COO 11 C-H COO
A: NOTE:- kindly repost 1st reaction ,as the image is blur, thus couldn't see the picture clearly.…
Q: Convert the following reactions into "Metabolic Engineering" notation: a. C6H1206 + 2 H20 → 2 C2H60…
A: A set of metabolic reactions and processes involving the conversion of chemical energy into ADP is…
Q: On the free energy diagram shown, label the intermediate (s) and transition state(s). Is the…
A: A chemical reaction is a phenomenon where certain substances react resulting in the formation of the…
Q: Given the following reaction, identify the class and subclass of the enzyme involved. ÇH2OH…
A: The enzymes can be classified based on the type of reaction that is catalyzed. The enzyme classes…
Q: The enzyme which catalyzes the reaction below belongs to which enzyme classification? || С—о- HC=0 +…
A: Enzyme accelerates the rate of reaction by reducing the energy required to initiate the reaction,…
Q: Please name the missing product marked x in this reaction H-Q АТР + C--0 - X + ADP
A: In such reaction ATP molecules is reacts with carbonate molecule which gives ADP and carboxyl…
Q: Identify the intermediate in the phosphoglucomutase reaction.
A: Phosphoglucomutase is an enzyme that helps in the interconversion of glucose 6 (G6P) phosphate to…
Step by step
Solved in 7 steps with 5 images
- Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.A chain NH3 NH3 B chain Gly Phe 2. The protein pictured below is bovine insulin. Determine the number and the size of the fragments that would be generated upon treatment with the following: İle Val Val Asn Gln Gln 5 Ġln 5 His look for the cleavage points (a) without DTT and (b) with DTT. Cys Leu Cys S-S Cys Without DTT With DTT Ala Ģly Ser Ser Trypsin 10 Val 10 His Cys Leu Chymotrypsin Ser Val Leu Glu BrCN Tyr Ala 15 Gln 15 Leu Leu Тyr Ġlu Leu Ásn Val Тyr Cys 20 Çys 20 Gly Asn Glu Arg Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C) Gly Phe 25 Phe Тyr Thr Pro Lys 30 ÁlaWhat is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? 5' His 119 RNA CH₂ H H 3 O Base 1' 12' 8-H His 12 -P-0-CH₂ a Base H H O -0-P=O H OH NH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his119 in order to stabilize the transition state. It donates a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his119 in order to favour the products of the reaction. Two of the above are true.
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopWhat is the role of his119 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? RNA -0-CH₂ Q Base His 119 H H NH His 12 -P-0-CH₂ a Base H H 3' H O 2' O-H OH O -0-P=0 It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his12 in order to stabilize the transition state. It serves as a general acid, donating a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his 12 in order to favour the products of the reaction. Two of the above are true.expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of D-tagatose
- Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the underlying rationale for the regulatory effects exerted on ribonucleotide reductase by ATP, dATP, dTTP, and dGTP.5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGProtease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of metalloprotease begins with generating a nucleophile that attacks the peptide bond that attacks the peptide carbonyl group. O Macmillan Learning On the basis of the information provided in the figure, show the next step in the mechanism for peptide-bond cleavage by a metalloprotease. Metalloproteases H R₁ HN Zn Enz 2+ R₂ Draw curved arrows on the pre-drawn structures to show the metalloprotease mechanism. If you need to reset the structures, click More followed by Reset Drawing. Select Draw Templates Groups More B - H Enz H H с R1 | : HN O | Zn 2+ B R2 N Zn Erase
- Nucleic Acids Convey polypeptide c' minal directi This ques similar to t' carboxy-ter- hesis ing synth to direct sis, the Secon yase aft e genetic groups of 44. Why is ATP important to protein function, and how is it used to accomplish this? which st is. The m fatthaei, synthetic able of r ataining r thus mus ucleotid h of mor Cwas the chemis re critir a 1966 ponded han our PROT mine the s tetail sizer. The following diagram shows the biosynthesis of B12 coenzymes, starting with the vitamin. DMB is dimethylbenzimidazole. (a) What one additional substrate or cofactor is required by enzyme B? (b) Genetic deficiency in animals of enzyme C would result in exces- sive urinary excretion of what compound?cip sequence rule in ephedrine