Match the given step with the major central dogma event being referred to. The U2 snRNP binds to the premRNA in a way that causes a specific adenosine residue to bulge out of the surrounding helix that later becomes the branch point of the lariat. O transcription termination O splicing: 2nd transesterification reaction O tailing, O transcription elongation O transcription initiation • O translation elongation O splicing: 1st transesterification reaction O translation initiation O capping O translation termination

Match the given step with the major central dogma event being referred to. The U2 snRNP binds to the premRNA in a way that causes a specific adenosine residue to bulge out of the surrounding helix that later becomes the branch point of the lariat. O transcription termination O splicing: 2nd transesterification reaction O tailing, O transcription elongation O transcription initiation • O translation elongation O splicing: 1st transesterification reaction O translation initiation O capping O translation termination

Name: 9 Match the given step with the major central dogma eyent being referr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 9 Match the given step with the major central dogma eyent being referred to.The U2 snRNP binds to the premRNA in a way that causes a specific adenosine residue to bulge out of thesurrounding helix that later becomes the branch point of the lariat.O t

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
TAN TTGC IGGAG Nanog regulatory sequence Given this interaction map which DNA sequence would the transcription factor most likely bind to? CAAGGAG ATTAACG TAATTGG TAATTGC
The Assembly of Class III Transcription Initiation Complexes consists of TATA-binding protein (TBP) TBP-associated factor (TAF) Both None
Describe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion ofmRNA that specifies the start of transcription.
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’
iestiðn Pre-initiation complex (PIC) is formed right before the initiation of genes, which of the following steps seemes to NOT help for the PIC formation? O TBP protein to recognize TATA box at promoter region O TFIIA to recognize the TAFS in TFIID O Enhancers to attract coactivators and activators O Silencers to attract repressor and corepressors
Describe the transcription initiation (on the example of mRNA synthesis by RNA polymerase II).
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
In eukaryotes, which of the following factor likely regulates the specific association of RNA polymerase(s) to a specific gene? O mediator complex O histones RNA polymerase O enhancer
In 3-4 sentences eachExplain the difference between prokaryotic and eukaryotic transcription. Explain the difference between an activator and a repressor? Explain the difference between a promoter and an enhancer? Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?
The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.