Looking at the picture what is the frame of the ORF?

Q: what is the mRNA Sequence? ATC GG ATACAAT

A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…

Q: Explain how xylem and phloem enabled some land plants to inhabit drier environments than their…

A: In vascular plants, xylem transfers and stores water and water-soluble nutrients. Sugars, proteins,…

Q: Is the DNA strand in the picture in the template or the non-template strand.

A: Deoxyribonucleic acid also called as DNA which is a polymer composed of two polynucleotide chains to…

Q: After eating a doughnut, your pancreas produces [ Select] [Select] [Select] " After intense…

A: Glycemia is the assessment of glucose level in blood of people or other animals. It is often…

Q: 마이다 어마어마 마이다이어리이다 ㅁㅇㅁㅇ ㅇㅇㅁㅁㅇㅁㅇㅁㅇㅁㅇ 1) The following pedigree shows a pattern of inheritance of a…

A: The answer is maternal imprinting; male parent

Q: In fruit flies, long wings (M) is dominant to miniature wings (m) and red eyes (B) is dominant to…

A: Introduction:- Genes are known as the units of inheritance. They are present on the chromosomes, in…

Q: Vertebrate phylogenetic tree St. bony fish amphibians mammals turtles lizards snakes crocodiles…

A: sister taxa are pairs of terminal taxa  branch from a common node and are often closely related…

Q: 2) Answer the following questions about an experimental preparation where you have cut all nerves…

A: Frog's heart Contains three chambers and no division between oxygenated and deoxygenated blood. It…

Q: Question: How many hours minimum must you incubate the gelatin hydrolysis test?

A: Gelatin hydrolysis test This test is used to assess an organism's capacity to create the…

Q: The following mRNA is found inside a yeast cell:  5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand:  5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions below the…

A: The question is to analyse the picture and answer the questions accordingly. Let's move on to the…

Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…

A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…

Q: Discuss how the body uses/processes alcohol and state why alcohol is good or bad for an athlete in…

A: The metabolism of alcohol is controlled by both environmental and genetic factors. The differences…

Q: xplain the data below and why knockout of Angpt2, MMP3 and MMP10 appears to inhibit metstastasis.

A: MMP stands for matrix metalloproteinase is a multi-functional factor that plays a crucial role in…

Q: What is the description of the growth and growth pattern of the microorganisms in the spread plate…

A: In the spread plate method, the growth of microorganisms is determined by the number of colonies…

Q: Based on similarities among forelimbs, what bones did the common ancestor of tetrapods probably…

A: Introduction : Homologous organs are those organs that have a common origin but different functions.…

Q: 1. In general, why do you think GWAS is useful? What kinds of problems could GWAS be used to solve?

A: The branch of Biological Sciences that deals with the study of genome is known as Genomics. The…

Q: 13. What is the effect of the following in the DNA isolation process: affect isolation solution…

A: DNA isolation is a process through which the intact DNA of the organisms is extracted and used for…

Q: If you experimentally removed the histones from the cells you are growing in your lab, how would…

A: Histones are extremely basic proteins which are located in the nucleus of eukaryotic cells and are…

Q: Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these…

A: Introduction  Some of the only living things that can generate their own energy are plants. The…

Q: What are some affordances of visual mediums?

A: Visual mediums are of many types like digital and printed images, posters, photography, graphic…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which…

A: Using the signal recognition particle (SRP), the co-translational route transports secretory…

Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…

A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…

Q: What is the lac operon?

A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…

Q: Crystal Uric acid Amorphous urates Calcium oxalates Amorphous urates Calcium phosphate Triple…

A: Blood volume and concentration, as well as blood pressure, pH, and glucose levels are all controlled…

Q: Compare the mechanism of ATP production in photosynthesis and cellular respiration (aerobic and…

A: Photosynthesis and cellular respiration are the two very important biochemical processes that are…

Q: In a workplace, what circumstances causes health issue and injuries? What actions can be done to…

A: The office is a crucial location for initiatives that safeguard your wellness, promote it, and avoid…

Q: Question: Which macronutrient does fermentation consume to make the fermented food a)Protein…

A: Introduction Fermentation is the process which occurs in the absence of oxygen. It is a biochemical…

Q: ist the inhibitors and activators of the Pyruvate Dehydrogenase Complex observed in most species?

A: Pyruvate dehydrogenase (PDH) complex is a multi-enzyme complex and catalyzes conversion of pyruvate…

Q: Calculate the number of Alu elements present in the haploid human genome based on the number of Alu…

A: Introduction :  The haploid human genome contains approximately 3 billion base pairs of DNA i.e…

Q: According to the lab, tools are of value for a variety of reasons including____. a. providing access…

A: Prehistoric men have been using stone tools and this has been developed over millions of years.…

Q: vide a explantion of the Intracellular mechanism of smooth muscle relaxation via antagonists such as…

A: Antagonist is any chemical that when binds to the receptor exerts the opposite effect of the agonist…

Q: || AB ||| AA 1 0₂ AA AB 2 BB 0₁ In this pedigree A and B represent alleles at a marker locus very…

A: Introduction : The study of a specific trait that is passed down from one generation to the next is…

Q: Organisms ATP NADH NADPH FADH2 Ethanol 1 20 100 0 0 50 2 350 400 0 100 1 3 500 410 200 100 1 Three…

A: Energy is spontaneously produced during cellular respiration, which involves several metabolic…

Q: Draw and label the different steps, including the DNA, RNA’s, the enzymes involved,  in translation…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…

A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…

Q: For each statement below indicate whether it is true or false. A. Introns are transcribed regions…

A: A. Introns are transcribed regions that are not removed in RNA processing - false Explain - specific…

Q: Based on the group it belongs to, which land plant innovations are possessed by Dicranum scoparium…

A: Introduction Vascular plants, otherwise called Tracheophyta, structures an enormous group of plants…

Q: Trafficking of proteins in a cell is distinguished solely by different protein sequences, such as…

A: The movement of proteins from one place to another is referred to as protein trafficking. ATP is a…

Q: The pedigree follows the inheritance of a relatively common trait.  Is the trait most likely…

A: A pedigree chart depicts the family members who are impacted by a genetic trait and a family tree.…

Q: Whare are five general reasons why scientists conduct surveys

A: A Survey is a study of behaviors, opinions, and needs of a particular group of people.  In a survey,…

Q: 46. List 3 parts of the brain that are specifically involved in memory a. Amygdala, Hypothalamus,…

A: The neuroanatomy of memory includes a broad range of brain structural features. It is now obvious…

Q: What happens during the regeneration stage of the Calvin Cycle? Energy from ATP and electrons from…

A: The stroma of chloroplasts in a plant cell undergo a sequence of processes known as the Calvin…

Q: Which of the following cell-types are most likely to secrete Matrix Metalloproteases (MMPs) that…

A: Matrix metalloproteinases, also known as matrix metallopeptidases or matrixins, are…

Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…

A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…

Q: A subject who is at 0-95ATM (211-02) has an arterial O₂ concentration of 19ml/dL and and arterial…

A: Oxygenation of tissues is crucial for maintaining the metabolic process that occurs in each and…

Q: Which variables are used when calculating the encephalization quotient? a. absolute brain size b.…

A: Encephalization quotient (EQ) is a relative brain size measure that is defined as the ratio between…

Q: In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments.…

A: In 1964 Nirenberg and Philip Leder, a postdoctoral fellow at NIH, discovered a way to determine the…

Q: Which of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are…

A: Calvin cycle is the part of photosynthetic reactions, where carbon is fixed into sugar. This…