look at the result of the following genotyping of three different members of the same family the to bonds in the gel electrophoresis result of the daughter suggest dna products of different lengths what does it mean
Q: Which of the following mobile genetic elements is a retrotransposon, making up about 15% of the…
A: A transposon may be a nucleic acid sequence which will modify its position among a genome,…
Q: Which of the following statements is true regarding gene duplication? (Check all that apply)…
A: Gene duplication is a major mechanism through which new genetic material is generated during…
Q: After much work the researcher maps the mutation in the mut1 plant to a locus on chromosome 2. The…
A: CoB1 gene is a component of the ubiquinol- cytochrome c reductase complex that is part of the…
Q: A research team interested in mapping human genes discovered a new restriction length polymorphism…
A: Restriction fragment length polymorphisms (RFLPs) uses the variations in DNA sequences of genome…
Q: Recombinant DNA is: a. DNA that is produced when genes from one kind of organism are introduced by…
A: Genetic engineering is branch of science which deals development of recombinant DNA and making…
Q: QUESTIVIES You are studying a group of individuals with X-ray vision and perform linkage analysis…
A: Restrictions enzyme or endonuclease are the enzyme which can cut the DNA at specific sites. Two…
Q: Ronan Farrow, son of the actress Mia Farrow, has grown up thinking that Woody Allen is his father.…
A: In the given scenario, Ronan Farrow who is the son of the actress Mia Farrow is looking for a…
Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…
A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…
Q: Which of the following is an example of a balanced mutation
A:
Q: Pick the statement about chromosome structure that is FALSE. Gene duplications provide an…
A: Chromosomes are long DNA molecule which carries the genetic information of an organism. They are…
Q: 1. You are studying a new gene “X” that you think controls skin color in Bearded Dragons. In order…
A: Polymerase chain reaction (PCR) It refers to the technique used by biologists to make millions and…
Q: While comparative genomics is fundamentally the study of the differences between the genomes of…
A: Comparative genomics is the study of genetics and other elements of biology by comparing the genomes…
Q: A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths…
A: The polymerase chain reaction is a molecular biological technique responsible for exponentially…
Q: Order the following steps according to the Sanger sequencing method The bands in the electrophoresis…
A: DNA sequencing is a technique used to evaluate the exact nucleotide bases , their position as well…
Q: A fellow lab worker brings you DNA containing what might be a similar gene in Leopard Geckos (XG).…
A: Introduction: The polymerase chain reaction is an innovative method for rapid amplifying specific…
Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…
A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…
Q: Imagine that you are researcher trying to identify genes that were involved in the domestication of…
A: Given information Two types of tomatoes are mentioned which are domestic and wild tomatoes. Each…
Q: You decide to use PCR to determine if you have another transposon insertion - this one on chromosome…
A: The polymerase chain reaction is the type of molecular biology technique that can lead to formation…
Q: Which of the following technologies can best differentiate between a diploid wild banana and a…
A: Edible banana have either 22 , 33 or 44 chromosomes that represent diploid , triploid and…
Q: Why is the DNA yield higher from 1g of strawberry compared to 1g of Arabidopsis leaves when both are…
A: DNA is present in each and every cell. All the genetic information of a cell present in the DNA. DNA…
Q: Based on the text for mosquitoes: 1. Compare the genetic relationship of the parent pest and its…
A: 1. Compare the genetic relationship of the parent pest and its offspring. Use the word: genetically…
Q: The Hemoglobin gene has two very common alleles: HbS and HbA. Bob’s professor asks him to draw the…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: While inspecting the genome sequence of your newly discoyered organism, you note that while the…
A: The GC content of an organism defines the percentage of the nitrogenous bases cytosine (C) and…
Q: Which of the following statements regarding gene duplication extra gene copies are highly…
A: Gene duplication is the process by which a region of DNA coding for a gene is copied. Gene…
Q: Genetic recombination as a result of crossing over occurs more readily in genes that are located…
A: Genetic recombination - It is a process in which DNA strands are broken and then recombined to form…
Q: Which of the following statements is TRUE about reverse genetics? Reverse genetics analysis starts…
A: The protein is the final product of a particular gene that determine the particular phenotype of an…
Q: ou are an expert molecular biologist and you just had your regular PCR run and you are now checking…
A: Polymerase Chain Reaction PCR is an effective technique for producing large quantities of specific…
Q: You are handling a paternity lawsuit brought against five poten woman. You isolated DNA from the…
A: Answer. DNA fingerprinting DNA fingerprinting also known as DNA typing or DNA profiling is a…
Q: Fill in the blanks:
A: Linkage is defined as the mechanism of inheritance of two or more genes together because the…
Q: High Frequency Recombination results in which of the following? O 1) Plasmid DNA incorporated into…
A: The bacterial DNA is arranged as a circular chromosome. The bacterial genome has a single origin of…
Q: 1. (a) alpha-globin in cow and pig orthologous genes paralogous genes pseudogenes…
A: The gene is the functional unit of heredity. The gene codes for proteins that produce characters…
Q: What is a genetically identical copy of an organism? a.Karyotype b.Clone c.Autosome d.Diploid
A: A gene is present in different forms that are expressed in a phenotype; allele is a one of the…
Q: Satellite DNA Select one: Is found outside of the nucleus Is a term used to describe very small…
A: Satellite DNA consists of large amount of tandem repeats that are non coding (do not produce any…
Q: Edward’s syndrome in humans (trisomy 18) is characterized by which genetic feature? it involves a…
A: GENETIC DISORDER It is an inherited medical condition caused by a DNA abnormality. It arises due to…
Q: Which of the following is not true about scaffolds in a genome assembly? Group of answer choices…
A: A scaffold is a section of the genome sequence reconstructed from whole-genome shotgun clones that…
Q: fellow lab worker brings you DNA containing what might be a similar gene in Leopard Geckos (XG). She…
A: Polymerase chain reaction (PCR) involves amplification of a nucleotide sequence using respective…
Q: Barbara McClintock: a. Discovered Telomeres that protect chromosomes from end to end fusion b.…
A: Barbara Mcclinton studied about Transposons in Corn and also told the importance about telomeres.…
Q: There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused…
A: Dear student, as per our honour code we are authorized to answer one question at a time with maximum…
Q: ou are studying a new gene “X” that you think controls skin color in Bearded Dragons. In order to…
A: This is a question about gene amplification.
Q: A research team interested in mapping human genes discovered a new restriction length polymorphism…
A: Restriction fragment length polymorphism (RFLP) is a form of polymorphism that occurs when…
Q: The following gene arrangements in a particular chromosome are found in different geographic…
A: An inversion is a chromosome adjustment where a portion of a chromosome is turned around from start…
Q: Southern blotting is a method used in molecular biology for detection of a specific DNA sequence in…
A: Nucleic acid blotting is a well-established technique for locating a gene or sequence of interest…
Q: Could I get a background on the repo gene (reversed polarity
A: repo gene is reversed polarity gene that is abundantly studied in Drosophila melanogaster.
Q: Which of the following statements about gel electrophoresis is false? Choose all that apply.…
A: Gel electrophoresis is a technique used in the separation of DNA fragments .
Q: The following diagram shows the genetic map of an individual in the region of a gene that has a…
A: There are fifty percent chances of child getting marfan syndrome because marfan syndrome is caused…
Q: A sudden, novel genetic change which can be stably inherited (as in the case of red flower color…
A: Introduction Genome is basically consisting of DNA which is composed of deoxyribose nucleotides.…
Q: The image shows the genetic code of an organism before and after the occurrence of a spontaneous…
A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- An Hfrstrain that is a *b*c*d* e*f* g *h* is mated with an F strain that is a b e d e f gh. The mating is interrupted at 5 minutes interval, and the genotypes of the F recombinants are determined. The results obtained are tabulated in Table 2. Draw the map of the Hfrchromosome and indicate the position of the origin of transfer, the direction of the transfer and the minutes between genes. Table 2:Entry time of Hfr chromosome into recipient cell. Time a d e f h 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’Describe the Holliday model and the double-strand break model for homologous recombination
- In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crassa (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome?Post replicative recombination between homologous chromosomes has 2 major benefits. What are theyCONNECT Two loci exhibit 5% recombination between them. How many map units apart are they?
- The results of a paternity test are shown in the table below. Numbers indicate the number of short tandem repeats for loci tested. Whos the daddy? How sure are you?Tick all the essential steps to demonstrate a genetic linkage between a disease and a molecular marker in humans. identify the alleles of the genetic marker only for diseased individuals in the pedigree enumerate parental type individuals sequence the wild-type and mutant alleles to find the mutation no correct answer calculate a Lod score calculate the recombination frequency between the mutation and the molecular marker identify the alleles of the genetic marker for each individual in the pedigree pedigree analysis cloning the defective gene enumerate recombinant individualsFor each genotype in the table below, determine whether or not functional B-gal will be produced in the presence or absence of the inducer. Write a plus (+) if B-gal is produced or a minus (-) if it is not. ma Chromosome F' lac (plasmid) - Inducer + Inducer ---- --- --- I*O*Z I*O°Z+ I*O*Z* I* = wildtype repressor |- - no functional repressor produced O* - wildtype operator OC = operator mutation prevents repressor from binding %3D
- The following recombinants are recovered when conjugation occurs between an a*d*g+ donor and an adg recipient. at d+ g+ = 84% a d g+ = 6% at d g+ = 10% a dt g+ = less than 1% What is the map distance between the a and d genes? 10 map units 74 map units less than 1 map unit 84 map units 6 map unitsHere is a strawberry karyotype - ignore the different colours. How many chromosomes are shown in the figure? What is the ploidy of this type of strawberry? How many alleles could an individual strawberry have at each locus? Finally during the G2 stage of cell division, how many double helixes would be in this picture if you drew them over the chromosomes? Many domesticated plants are polyploid - give one possible reason why this might be the case, with a focus on using genetic principles to reason it out (i.e., you don't have to be right per se, you have to build an argument based on what you've already learned).Shown below are eight DNA sequences from different individuals QHow many different haplotypes (sets of linked variants) are found in these eight sequences