Look at the graphs of other organisms. What observations can you make about the data in the graphs? (Which bases are present in equal numbers here- are they all the same as on your chart?) Look at the graphs again. Do you notice differences between organisms? What is the difference? Are there any organisms that are similar? If yes, why do you think those organisms are more similar than others?

Look at the graphs of other organisms. What observations can you make about the data in the graphs? (Which bases are present in equal numbers here- are they all the same as on your chart?) Look at the graphs again. Do you notice differences between organisms? What is the difference? Are there any organisms that are similar? If yes, why do you think those organisms are more similar than others?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2VQ

See similar textbooks

Similar questions

Give only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'
Hi! Can you give an explanation for each sample identity in paragraph form (for the rationale)? Thank you.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
DNA sequences CGCCTAGTCA Strain 1 TCCCTACT CG Strain 2 ATCCTATAAC Strain 3. GACCTAAGCT Strain 4 Strain 2 = Strain 3 = 40 Strain 4 = 50 60 70 d Please use the above figure for the following question. If no figure appears, please use Figure 4. Fill in the blanks by writing the letter of the location where each of the strains belongs in the cladogram. Strain 1 = Percent Relatedness b
Eienskap/Property A-DNA B-DNA Z-DNA Algehele proporsies/Overall Kort en 1.3.1 Verleng en proportions breed/short and dun/elongated and thin broad 1.3.2 Regshandig/right- Regshandig/right- Linkshandig/Left- handed handed handed Basepare per heliksdraai/base 1.3.3 "10 12 pare per turn of helix 1.3.4 anti anti anti (C), syn (G)
Xmal EcoRI Xmal EcoR 1300 bp 1.28 be 1200 bp 1100 bp 1000 bp 900 bp 800 bp 770 bp 708 bp 611 bp 700 bp 673 bp 611 bp 575 bp 600 bp 575 bp s00 bp 400 bp 300 bp 200 bp 100 bp 62 bp 50 bp The 16s FDNA of Escherichia coli consists of 1,956 bp (1.956 kb) МАРPING Xmal 611 bp 70 bp S75 bp EcoRI 673 bp 1,283 bọ Xmal & EcoRI (double digest) 611 bp 62 bp 708 bp 575 bp Electrophoresis Result
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
Protien searches are usually more informative than DNA searches. Perform a BLASTP search using RBP4 (NP_006735), restricting the output to Arthpoda (insects). How many database matches have an E-value less than 1.0 in each search ?
Which two species in this DNA sequence alignment are the most closely related? Explain your answer referring to specific nucleotide positions to justify the choice you made.
This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
The text stated that molecular biologists have developed elegant techniques that can convert any type ofDNA end into any other type of DNA end. In thisproblem, consider genomic DNA that is broken bymechanical shearing into random pieces. Some of theends of these pieces are blunt, some have 5′-overhangs, and others have 3′-overhangs.a. Must the two ends of any one genomic DNAfragment be of the same type?b. Explain why the ends with 5′ or 3′ overhangs arenot sticky.c. Researchers can convert ends with overhangs intoblunt ends using either DNA polymerase (plus thefour dNTPs), or nuclease S1, which degradessingle-stranded regions of DNA but not doublestranded regions. Which kinds of ends with overhangs (5′ or 3′) could be converted into blunt endsusing DNA polymerase? With S1 nuclease?