Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Suggest an experiment to determine if the uptake of a compound is by either facilitated or active…
A: The cell membrane or plasma membrane is the outermost layer that encloses the cellular contents. It…
Q: Coat color in mice (Mus musculus) can show many varieties. You have two true-breeding mouse stains,…
A: True breeding is a type of breeding in which the parents produce offspring with the same phenotype.…
Q: How many TsdB cells would you expect if chromosomal interference = 0? ____6-7_______ why is that…
A: A crossover event in one area of a chromosome diminishes the possibility of another crossover event…
Q: An organism has the chromosomes below where the letters represent genetic loci and the period…
A: Chromosome aberrations are modifications to the number or structure of chromosomes within the genome…
Q: slect All four trees have the same topology. Each of the four trees has a different topology.…
A: Tree topology denotes the pattern of evolutionary relationship among a group of species. It is…
Q: Chi Squared Problems In the garden pea, yellow cotyledon color is dominant to green, and…
A: Total number of Phenotypes obtained- 556 + 193 + 184 + 61 = 994In order to calculate expected…
Q: Below is a picture that depicts transcription. Shown is the DNA double helix, the replication…
A: Transcription is the process where the mRNA sequence complementary to the template strand is…
Q: FIGURE 3. DNA was extracted from yolk sacs of E9.5 embryos derived from Tak1+/A intercrosses. The…
A: In this process it is clearly seen that some kind of DNA or a gene is isolated. Later on different…
Q: Why is cytosolic K+ highly concentrated when the extracellular K+ concentration is low even though…
A: The concentration of potassium ions (K+) inside a cell's cytosol is a finely regulated phenomenon…
Q: Match the organelle/cellular component to its function: Contains enzymes that break down and digest…
A: 1.Cystosol - jelly like fluid inside the cell2. Ribosome - helps in synthesis of proteins.3. Smooth…
Q: Gouty tophus H&E staining Mark the corresponding elements in the pictures 4.1, 4.2 and 4.3: 1 - foci…
A: The study of gouty tophi through Hematoxylin and Eosin (H&E) staining gives a detailed view of…
Q: Five loci defined by microarrays are known to contribute to meat quality in cattle. Premium meat…
A: You need to determine the possibility that the first offspring of a cow and bull cross would have…
Q: Metastasis occurs when cells from a primary tumor invade and colonize other tissues. Metastasis is a…
A: Metastasis is a critical process in cancer progression where cancer cells from a primary tumor site…
Q: words, describe the differences you see for each organism grown at 30 C or 37 C (i.e., amount of…
A: Microorganism have their own optimal growth at an optimum tempearture and pH. In these pictures, we…
Q: What are the 3 components of total energy expenditure (TEE)? In the component that makes up the…
A: Total energy expenditure (TEE) is the amount of energy used in a 24-hour period during the oxidation…
Q: homodimers
A: Based on the oligomeric states of proteins, are classified as homodimers, homotrimers and…
Q: True or False. Explain. Nucleosomes are aided in their formation by the high proportion of…
A: The statement given relates to the formation of nucleosomes, which are crucial units of DNA…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…
Q: One reason that the osmolarity becomes higher at the bottom part of the loop of Henle is because A)…
A: Henle's loop is a long, U-shaped section of the kidney's nephron tubule found in mammals, birds, and…
Q: Hormones Affect only other hormone producing organs Remain at a constant concentration in the…
A: Endocrine system involves different glands that contains several specialised cells. These cells…
Q: discuss in detail the normal physiology of RBC production.
A: Red blood cells are also known as erythrocytes. Its major function is to transport gases through…
Q: 1. Draw 8 phospholipid molecules arranged to show how the phospholipids will orient themselves on…
A: Phospholipids are the biomolecules that act as the main constituent of cell/plasma membranes.These…
Q: fossil of what you think is the common ancestor of the new species of ape and all other gorillas.…
A: The whole branch of biology which deals with establishing the relationship between two species is…
Q: Basic characteristics 1. d. Hydrophilic core Hydrophobic bilayer Cholesterol Phospholipids…
A: All the images are lipid based structures. These are same woth respect to the fact that all of them…
Q: Since prokaryotes don't have microtubules, how does intracellular movement occur? For an example,…
A: Prokaryotic cells are the Earth's earliest single-celled microorganisms. Prokaryotes include…
Q: *Ms. Libby Davison bought three Congo Lily bulbs at a flower show after she was told they were each…
A: R for Red alleleY for Yellow alleleW for White allele
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…
Q: How can 5-HT2a activation be linked to dream-like experiences and hallucinations, but serotonin is…
A: 5- HT2a is a receptor antagonist it results in significant but differential regulation of mRNA…
Q: In mallard ducks, Anas platyrhynchos, plumage is under control of a single gene with three alleles:…
A: If a gene exists in more than two alleles such condition is called multiple allelism. Eg. Blood…
Q: Explain why K+ channels not allow Na+ to pass even though Na+ is a smaller ion, and Na+ and K+ are…
A: Potassium channels are specialized membrane-spanning proteins made up of four subunits that create a…
Q: Convert daT NA TO CONA Commtur production Transformicol of Excherichia col HockBST co BST MANA from…
A: Cloning in genetics and genomics refers to the use of scientific methods to create identical, or…
Q: Please explain why, thanks in advance. A. green - A_B_ and A_bb, virescent-white - aaB_, yellow -…
A: This is an example of dominant epistasis in which the ratio of the offsprings obtained is 12 :3 :1.…
Q: 1.state the principle and uses of real time pcr and microtiter plate 3.state two uses of distilled…
A: Real time PCR is based on the accumulation of amplification products. The quantification of these…
Q: A woman without red-green colorblindness and with a normal chin, whose mother was colorblind,…
A: Genetic inheritance patterns come in two flavors: autosomal dominant and sex-linked recessive. The…
Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…
A: Mutation is the change in DNA sequence or the number of chromosomes in an organism. In some cases…
Q: Explain how the transfer of electrons from one electron transport chain complex to the next,…
A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…
Q: The following four plants have been identified as having the listed gametophytic…
A: Self-incompatibility (SI) is defined as the inability of a fertile hermaphrodite plant with stamens…
Q: Threatened species often have small, isolated populations where mating between relatives occurs.…
A: When two ancestrally unrelated species mate and produce offspring it is known as inbreeding. The…
Q: 1 (a)Why is the spectrophotometer set at 0.000 absorbance for the uninoculated tube of broth? (B)…
A: A spectrophotometer is an instrument that measures the number of photons (light intensity) absorbed…
Q: Question 38 If human gametes were diploid the products of fertilization would have more…
A: DNA is the genetic material of living organism. DNA is a double stranded macromolecule that contains…
Q: Briefly describe how thyroid hormones is made in the thyroid gland. What are the necessary…
A: The synthesis of thyroid hormones in the thyroid gland is a complex and highly regulated process…
Q: The epidermis is comprised of There are two types of specialized cells within the epidermis.…
A: Either of the four major cell types that make up the epidermis may be referred to as "skin cells."…
Q: What happens in the reception phase of cell signaling when protein signal molecules are present?…
A: The cells in a multicellular organism communicate with each other through various signaling…
Q: A. During the knee bend, identify the thigh muscles that are performing the following: Concentric…
A: An isotonic contraction is a form of muscle contraction where the tension within the muscle changes…
Q: Which of the following is TRUE about gametes? a) undergo meiosis b) formed by mitosis c) always…
A: Please note, the given questions are four different questions and not sub-parts of one question.…
Q: QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies…
A: Polyphyletic taxa include groups of organisms that share a common ancestor but also include some…
Q: Since Western and Eastern meadowlarks are similar in appearance, one could assume that both are…
A: A species taxon is a collection of creatures that may effectively interbreed and give birth to…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: A pathogen is a microorganism, such as a bacterium, virus, or fungus, that can cause diseases in…
Q: C. What genotypes lead to the phenotypes of the F2? What phenomenon is occurring in the F2…
A: Saccharomyces cerevisiae, bakers yeast is an model unicellular organism for genetic experiments. It…
Step by step
Solved in 3 steps
- Which of the following is not correct about phosphorylation by IRS on serine residue? a) Target tissues fail to respond to circulating insulin b) It increases insulin levels c) It is an inhibitory phosphorylation d) It is molecular mechanism for insulin resistanceAntagonistic Hormone a) Describe how glucagon and insulin function to regulate blood sugar levels. b) Explain why they are considered to be antagonistic hormones.Pancreatic beta cell dysfunction in type 2 diabetes is probably related in part to: a) Decreased advanced glycation end products b) Autoimmune destruction of the beta cells resulting in no insulin secretion c) Decreased beta cell mass d) Increased glucose-stimulated insulin secretion
- Under stressful conditions epinephrine is released from the adrenal medulla. The release of epinephrine has which of the following effects on glucose metabolism? A) glycogenolysis is stimulated B) glycogenesis is inhibited C) adenylate cyclase is activated D) Both A and B E) All of the above15.18) Determine whether the following statements describe insulin, glucagon, or both insulin and glucagon. a) secreted by pancreas both insulin and glucagon b) released when blood glucose concentration is high insulin c) released when blood glucose concentration is low glucagon d) immediately increases the amount of glucose entering cells insulin e) is a hormone both insulin and glucagon f) lowers blood glucose concentration insulin g) not enough is produced by individuals with type-1 diabetes insulin h) stimulates glycogen breakdown (glycogenolysis) glucagon EXPLANATION: When insulin binds to liver and muscle cell receptors, it triggers a series of events that result in the activation of an enzyme in the glycogenesis pathway and the inhibition of an enzyme in the glycogenolysis pathway. Glucagon has the opposite effect of insulin on liver cells; it accelerates glycogenolysis and suppresses glycogenesis causes a decrease in blood glucose levels • accelerated by insulin suppressed by…2. State which hormone is probably responsible for each physiological phenomenon described below and explain why. a) Blood glucose levels remained constant even though someone went 20 hours without eating or drinking. b) Heart rate and breathing rate increase when someone is awoken by a loud noise in the middle of the night. c) A grown man's jaw and forehead become thick and deformed.
- The pancreas produces tiny amounts of insulin 24 hours a day. This small amount of insulin keeps glucose levels stable between meals and during sleep. This tiny continuous production of insulin is called:a) Basal insulinb) Bolus insulinWhat is the role of counter-regulatory hormones in the regulation of blood glucose? Question 8 options: a) To inhibit glycogenolysis b) To inhibit hepatic glucose production c) To increase insulin sensitivity of peripheral tissues d) To enhance gluconeogenesisInsulin and glucagon are controlled by negative feedback mechanisms. Put them in the right order from when you eat. a)Glucose enters the bloodstream faster than the cell can use it. b) Glucose levels rise. c) Beta cells of pancreas are stimulated to release insulin into blood. d) Cells take up glucose. e) Cells of the liver convert glucose to glycogen f) The level of glucose in blood stream returns to normal.
- 1.20-year-old woman with diabetes mellitus was hospitalized with confused consciousness,fever,nausea,vomiting and fruity smelling breath. A urine sample was strongly positive for ketone bodies.Why would an insulin injection decrease her ketone body production? For the answer: a) indicatethe causes of diabetes mellitus:describe the scheme of signal transduction by insulin. b)compare the blood glucose levels in healthy patients and in patients with diabetes mellitus; c)explain why ketone bodies synthesis is activated in this patient: describe the schemes of ketone bodies synthesis and oxidation.(human physiology) 1) Match the insulin types (1-3) with the plots (A-C)? Explain? 2) Oral administration (e.g. in the form of pills) of insulin and subcutaneous administration, which is more effective? Why? 3) Why are elderly, sedentary, obese and regular smokers at high risk of diabetes?Epinephrine secretion: a) activates adenylate cyclase in liver and muscle cells. b) activates protein phosphatase 1 in liver and muscle cells. c) activates glycogen phosphorylase a in liver cells. d) inhibits glycogen phosphorylase in brain cells. e) inhibits glycogen phosphorylase b in muscle cells.