Q: Which of the following occurs during synaptic transmission? Select ALL that apply A) vesicles…
A: Introduction : A synapse is the point at which two neurons come together, or between a neuron and a…
Q: Predation is an interaction between two species best described how? One species benefits from the…
A: Predation is the type of interaction in which an organism (predator) kills and eats the other…
Q: In a certain population of frogs, 120 are green, 60 are brownish green, and 20 are brown. The allele…
A:
Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…
A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…
Q: What is the most accurate way to introduce mutations to particular regions in the genome? Using…
A: An modification to the genome's nucleotide sequence of an organism, virus, extrachromosomal DNA, or…
Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…
A: Introduction Gene expression is the process through which a gene's information is utilised in the…
Q: Which of the following IS NOT a form of cell-to-cell communication? Release of a steroid hormone by…
A: A step-by-step process, cellular communication involves the production of an extrinsic signal,…
Q: In paragraph how can a community sustain environment?
A: Environmental sustainability is connected with the careful or attentive use of the resources which…
Q: Acetylcholine (ACh) is the primary neurotransmitter responsible for muscle contraction. The binding…
A: Acetylcholine is a neurotransmitter that is found in both the central and peripheral nervous…
Q: A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice…
A: A culture media for microbes is a mix of substances that can promote and sustain the growth of…
Q: In the following study, which are the experimental result and control variables? Number of spiders…
A: Introduction : In scientific experiments, a control variable is an experimental component that…
Q: What are the units of absorbed dose? What are the units of Biologically Equivalent Dose?
A: Ionization occurs when radiation strikes and knocks electrons off an atom, resulting in charged…
Q: please make a venn diagram about the characteristics of cats and dogs. PLEASE MAKE IT BROAD
A: Venn Diagram - A type of diagram that uses overlapping circles to represent the logical relation…
Q: Which of the following is an objective for the following study: Male birds are usually more colorful…
A: Males are often more colourful than females in the animal world because of sexual selection. This…
Q: Question: To cause overexpression of the genes it controls, would MECP2 protein have to remove…
A: The MECP2 gene codes for the production of a protein known as MeCP2. This protein regulates gene…
Q: 1. What are the different types of chromosomes? Draw and discuss each. 2. Discuss the following…
A: A biological process called the sex determination mechanism controls how an organism develops its…
Q: Which of the following elements is necessary for an epigenetic effect to take place? Inheritance of…
A: What is the epigenetic effect? Epigenetics deals with the study of phenotypes that environment can…
Q: how ultrafiltration works in the capillaries to move fluid between the blood and the surrounding…
A: ultrafiltration occurs at barrier between the blood and the filtrate in bowman's capsule in kidneys.…
Q: 4. Select the location where each of the following starts its function in protein synthesis. a. mRNA…
A: The mRNA or messenger RNA carries information from DNA to form protiens. Ribosomes are the…
Q: A certain autosomal recessive trait occurs in a population with a frequency of 1 in 4900. Assuming…
A: According to Hardy-Weinberg Principle, there will be a constant genetic variation in a population…
Q: 1. What are the possible explanations for why the hominid lineage may have favoured bipedal…
A: 1. The bipedal movement might have been a coping mechanism for surviving in an environment with…
Q: Is eating of dog meat good or bad? Essay
A: Food is a material that is mostly made up of nutrients such as protein, carbohydrates, and fat. It…
Q: Which of the following describes the most direct source of energy for anabolic reactions in living…
A: The metabolic reactions are the chemical reactions that occur in the cell that helps to provide…
Q: Unripe fruits are hard and tart. Ripening is a process that sweetens and softens the fruit to make…
A: A positive feedback loop accelerates ripening when ethylene is present because it encourages the…
Q: An evolutionarily stable strategy (ESS) is a Group of answer choices strategy that, if adopted by…
A: Introduction Evolutionarily stable strategy (ESS):- A behavior that all animals within the…
Q: The energy for the production of ATP comes from the breakdown of a glucose molecule via many…
A: Oxidative Phosphorylation is the process of formation of ATP and it is the final step of cellular…
Q: Figure attached, you don't need any of the textbook words to figure out the answer so don't worry…
A: Both in the presence and lack of oxygen, yeast may survive. Cells normally grow smaller under…
Q: 1- Reproductive isolation could happen in bird species if a) The birds have different singing sounds…
A: Reproductive isolation is the type of isolation that occurs when a population splits into two groups…
Q: For this plant with binomial name Ixora coccinea L., What is the reference to the original…
A: Ixora coccinea is a dense, multi-branched evergreen shrub that typically grows to a height of 4-6…
Q: LO73 Determine which nucleotides are methylated based on a sequence that has been treated with…
A: Introduction : Bisulfite sequencing is the process of treating DNA with bisulfite before performing…
Q: Describe one other indirect method of population sampling and outline its advantages and drawbacks:
A: There are a few important points : A population is generally a group of individuals of a particular…
Q: How do epigenetic marks compare in monozygotic twins? They stay the same throughout their lives…
A: Zygote is formed by fusion of male and female gametes. This process of fusion of gametes is…
Q: In a dihybrid test cross, the following results were obtained: A‑B‑, 121; A‑bb, 107; aaB-, 115; and…
A: A dihybrid cross is a type of cross in which two traits are involved . Each trait is illustrated in…
Q: Researchers have identified an enzyme that can catalyze two different chemical reactions. Which of…
A: Catalytic activity is defined as the ability of a substance to cause or accelerate a chemical…
Q: Endothermic animals can maintain consistent temperature conditions by generating, main- taining, and…
A: Incorrect options and why: A. Chloroplasts are only found in plants and are used for the production…
Q: 1. Complete the table
A: Rabies Poliovirus Hepatitis A Genome type Negative sense, non-segmented, single-stranded RNA…
Q: 13. In guinea pigs, the allele for short hair is dominant over long hair. Two short haired guinea…
A: The type of variant present at a specific locus (i.e., region) in the genome is scored by what is…
Q: In a population of 300 humans, the following blood type frequencies for the MN blood group are…
A: Blood group of an individual is determined by presence/absence of antigen on RBC 's surface and…
Q: TRUE OR FALSE Depolarization of the rod cell membrane causes increased neurotransmitter release.
A: Rod cells release more of their neurotransmitter when they are depolarized. This happens because…
Q: Do you believe stress is harmful to your health or part of life? Explain why or why not. Select 2…
A: The answer is YES. Stress symptoms can affect our body, our thoughts and feelings, and our behaviour…
Q: As DNA methylation increases, mRNA levels... Oincrease Odecrease
A: DNA methylation is a process in which the methyl groups are added to the DNA.
Q: Explain the phenomena of the loop of Henle.
A: Loop Of Henle long U-shaped portion of the tubule that conducts urine within each nephron of the…
Q: is located dorsal Which insect organ to the alimentary canal?
A: In case of insects, haemolymph is dynamic and not static, which means it is on either side of the…
Q: Explain the technologies and methods used for food production by modern society.
A: Since the inception of farming nothing much had changed before the Green Revolution. It was the…
Q: Which of the following could be identified as epigenetic effects?
A: This question is based on epigenetic effect.
Q: Which of the following variables would be appropriate as test variable if we want to test the…
A: In a population, directional selection happens when members with traits on one side of the mean live…
Q: find one primary research article about nurse plants, then do the following questions below: 1. That…
A: Nurse plant theory & its application in ecological restoration in the lower subtropics of China…
Q: A married couple makes an appointment to speak with you. Both have a genetic disorder, but they…
A: Genetics is a study of heredity and genes of how certain characteristics or qualities are passed…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTP1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sList and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?
- Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are necessary to form the pre-initiation complex (PIC) of RNA Pol II. The 5' cap of mRNA requires the free triphosphate on the nucleotide at the 5' end. Introns must be removed from the initial RNA transcipt. Histone acetylation is a method controlling gene expression. Acetylation creates more positive charges on histones, leading to tighter binding of the proteins to DNA. Exons are removed from mRNA by the spliceosome. RNA polymerase II must completely finish an mRNA transcript before processing can begin. RNA polymerase I catalyzes the synthesis of the majority of ribosomal RNA. The hormone 173-estradiol binds to a G-protein coupled receptor to control gene transcription.The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.In Plasmodium, describe the processing of lysyl-tRNA synthetase transcript, by including the localization within the cell, any processing and packaging in general. Any particles that bind to the mRNA molecules, exchange, any membrane to cross, any functional groups to be added
- Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5' CACUGAUGCACGGAUGAU 3' What is the THIRD amino acid that will be translated in the wild-type sequence? SECOND BASE G. C. uGu-Cystelne (Cys) Uac UGA -Stop codon UGa -Tryptophan (Trp) UCU Ucc UAU UAC Tyrosine (Tyr) Phenylalanine (Phe) UUC. Serine (Ser) U UUA UuG UAA -Stop codon UAG -Stop codon UCA Leucine (Leu) Uca. CGu cac ccu CUU CUC CAU Histidine (His) Leucine (Leu) Proline (Pro) CAC Arginine (Arg) CUA CaA CCA ccG CAA Cua Glutamine (Gin) caa CAG ACU ACC AGU AUU AUC AAU Asparagine (Asn) Serine (Ser) Isoleucine (le) AAC AGC Threonine (Thr) AUA ACA AAA AGA Methionine (Met) Start codon ACC AAG -Lysine (Lyn) AGG Arginine (Arg) AUG - GcU GAU GUU GUC GUA GUG Aspartic acid (Asp) GAC GcC GCA aco Valine (Val) Alanine (Ala) -Glycine (Gly) GGA GAA GAG Glutamic acid (Glu) O Cysteine O Methionine O Histidine O Glycine FIRST BASE THIRD BASEIn the absence of cladosporin, explain the elongation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in bacterial cells by including any elongation factors, base pairing of codon/anticodon, any conformational shift, proofreading, any hydrolysis, exchange, ribosomal subunits involved, charged tRNA, peptide bond formed. This question does not require a super long in depth answer, a short to the point answer is preferred if possible. Thank you!Ⓒ Macmillan Learning Classify the given examples of prokaryotic gene expression as positive or negative gene regulation. 54 $ R In the presence of excess tryptophan, a repressor protein binds the operator of the trp operon and prevents the operon from being transcribed. In the absence of lactose, the lacR repressor protein binds the lac operon. F4 Positive gene regulation In the presence of the sugar arabinose, an activator protein binds the promoter of the genes responsible for processing arabinose and induces their transcription. In the presence of iron, the dtxR repressor protein binds DNA, and the gene that encodes for the diphtheria toxin is not expressed. % 5 In the presence of lactose and low glucose, the lac operon expressed 20-fold higher than in the absence of lactose. T F5 < 6 MacBook Air MA F6 Answer Bank & 7 F7 Y U * 8 DII F8 Negative gene regulation 1 ( 9 F9 O ) - C J F10 | ! LIC