IV 1 = female - male 2 3 11 2 4 3 ? 4 C 2 5 5 3 4 6 6 The disease trait in this pedigree is autosomal recessive and causes a severe hearing defect. What is the probability that the 2 people indicated in IV (individuals IV-4 and IV-5) will have a child with the disease trait? OA. The probability is 1 in 2 OB. The probability is 1 in 12 OC. The probability is 1 in 4 OD. The probability is 1 in 8 OE. The probability is 1 in 6
Q: Which of the following are thin structures that extend from the surface of the cell and act in…
A: The kingdom Protista includes all eukaryotes that are not animals, fungi, or land plants. Protists…
Q: An important evolutionary innovation and a major difference between the limbs of extant lobe-finned…
A: Answer is option 4. i.e Limbs are supported by a single basal bone in tetrapods. So in tetrapods…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Q: Determine the experimental design that makes the difference between the given two modes of action at…
A: The antisense ribonucleic acid is a type of single-stranded ribonucleic acid molecule that binds to…
Q: The doctor ordered Piperacillin-Tazobactam 2 grams every 8 hours as IV infusion. The available vial…
A: The amount of drug given at one time to the patient is called a dose. The compounds used in medicine…
Q: Plant breeders have long appreciated the phenomenon called hybrid vigor or heterosis, in which…
A: Cytoplasmic male sterility (CMS) in corn is caused by defective mitochondrial genomes that impede…
Q: 2. Glycogenesis, reaction scheme and regulatory enzymes.
A: Glycogenesis is the mechanism by which simple sugars are joined to the glycogen chains for…
Q: What does the medial corticospinal tract control? A. Bilateral movements of the trunk of the body B.…
A: The corticospinal tract can be described as a motor pathway that initiates in the cerebral cortex…
Q: Modern Homo sapiens are not the only species to use tools. Which other animals use tools? a. some…
A: Introduction: Tool use by animals is a phenomenon in which an animal uses any different kind of…
Q: 4. In a given population of 1000 individuals, the allele frequencies are a = 0.4 and A = 0.6. What…
A: Given - Population size - 1000 Frequency of occurence of dominant allele (A) - 0.6 Frequency of…
Q: The somatic cells of a dog each contain 78 chromosomes. What is (are) the product(s) of…
A: The result is 39 chromosomes at the poles of the cell.
Q: Whare are five general reasons why scientists conduct surveys
A: A Survey is a study of behaviors, opinions, and needs of a particular group of people. In a survey,…
Q: 1 Sarah, a trainee of the electron microscopist at the local hospital, is reviewing some…
A: mitochondria is an essential organelle of cell that general energy by phosphorylation in form of…
Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…
A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…
Q: The so-called hypervariable regions (HV1 and HV2) of the human mitochondrial genome are sometimes…
A: HV1 and HV2 are two hypervariable regions found in the human mitochondrial DNA (deoxyribonucleic…
Q: A crucial step in the regulation of many bacterial genes is the binding of RNA polymerase to DNA at…
A: The synthesis of RNAs and proteins in accordance with the instructions contained in deoxyribonucleic…
Q: The amount of DNA per cell of a particular species is measured in cells found at various stages of…
A: Cell division is a phenomenon in which parent cell undergo splitting and give rise to novel cells.…
Q: This is an image of a lily flower. Based on your reading, please click the part of the flower where…
A: Sexually reproducing organisms produce male and female gametes. The fusion of male and female…
Q: Intracellular signaling pathways provide multiple opportunities for the amplification of a response…
A: there are several intracellular signaling pathways works together in a body that regulates normal…
Q: Below is a tulip flower. Based on your reading, click the structure or structures where pollen is…
A: A tulip is a flower with bright petals and is a herbaceous bulbiferous geophyte. It is a complete…
Q: Determine the possible explanation about generating the new kind of antibiotic for the treatment of…
A: Most people infected with toxigenic V. cholerae O1 have asymptomatic illnesses or self-limited…
Q: 10.0 8.0 6.0 5.0 4.0 3.0 2.0 1.5 1.0 0.5 MC 179 196 198 210 222 234 253 254 M נות
A: To pinpoint a specific gene's location on a chromosome, geneticists employ maps. In one kind of map,…
Q: Explain in detail how the of relaxion towards Smooth muscle contraction is done by the antagonsists…
A: Body organs move mechanically thanks to the process of muscular relaxation and contraction. The…
Q: Which of the following would be considered "extreme" environmental conditions for microbes? a) pH of…
A: Introduction Extremophiles are microorganisms that grow well in extreme environments, which humans…
Q: Which statement(s) below regarding DNA mutations is true: A. Mutations only occur in genes B.…
A: Ans: D) Mutation can occur in promoters. Mutation is a change in the sequence of DNA due to…
Q: 46. List 3 parts of the brain that are specifically involved in memory a. Amygdala, Hypothalamus,…
A: The neuroanatomy of memory includes a broad range of brain structural features. It is now obvious…
Q: glucose Glycoly sis (b). Glucose is split into two 3-carbon chains called AcetylCoEnzymeA in order…
A: Cellular respiration can be defined as a set of metabolic processes that occurs in the cells of…
Q: # File Arial Home 8 Insert Type here to search Draw B 1 U Layout Review ab X₂ View x AA EEZIE (0)…
A: Introduction Meiosis: It is the type of division of cell in which two stages results in four…
Q: Hello, please read the attached Microbiology question and answer the question correctly. *If you…
A: Introduction KIA is known as Klinger's iron test. it is used to detect the carbohydrate…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: Glycolysis Pyruvate Oxidation Citric Acid Cycle Oxidative phosphorylation Total Molecules produced…
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. In…
Q: The Multiregionalism model of modern human origins hypothesizes that____. a. some features of…
A: The evolution of humans is based on different hypotheses. There are two hypotheses which are more…
Q: A woman in her 60's has a brain biopsy following the identification of a brain lesion. The lesion is…
A: Brain biopsy Is a surgical technique that involves the removal of a sample of aberrant tissue for…
Q: What would be the f2?
A: Drosophila has been widely used in genetic studies as it produces a large number of offspring and…
Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…
A: INTRODUCTION Answers of a to l is given below.
Q: If a protein is acted on by a protein kinase, in what way does that change the protein’s structure?…
A: Protein kinases play an important function in cellular activation. A key component of activation is…
Q: Which cytosines could be methylated in a typical mammalian genome? Why? 5’-GCCGCGC-3’
A: DNA is the genetic material in living organisms that contain two polynucleotide trends. DNA contain…
Q: 2) Answer the following questions about an experimental preparation where you have cut all nerves…
A: Frog's heart Contains three chambers and no division between oxygenated and deoxygenated blood. It…
Q: After eating a doughnut, your pancreas produces [ Select] [Select] [Select] " After intense…
A: Glycemia is the assessment of glucose level in blood of people or other animals. It is often…
Q: Which statement is true concerning hominins and the archaeological record? a. There is a 10 million…
A: Human evolution is the evolutionary process, leading upon the appearance of modern human being.…
Q: In the kidney, inhibition of glucose reabsorption causes glucose clearance to do which of the…
A: Introduction The word renal is very much related to Kidneys. The main function of Kidneys is to…
Q: Read This! When phospholipids are added to an aqueous environment (consisting mostly of water) the…
A: Introduction Cells are box or chamber-like structures containing fluid cytoplasm enclosed by…
Q: Give the role of starch solution, phosphate buffer, and NaCI solution in the amylase test. What are…
A: The amylase test is a laboratory test used to measure the level of amylase in the blood. Amylase is…
Q: || AB ||| AA 1 0₂ AA AB 2 BB 0₁ In this pedigree A and B represent alleles at a marker locus very…
A: Introduction : The study of a specific trait that is passed down from one generation to the next is…
Q: Name the tissues that contained the highest concentration of peroxidase. 2. Describe one function…
A: Introduction : Several different biological processes involve a wide range of enzymes known as…
Q: Please draw a concept map using the following terms for regulation Repressor, Inducer, Induction,…
A: There is the regulation of gene expression in bacteria. It can be positive or negative regulation.…
Q: Write down the functions of the following body system. Body System Functions 1. Skeletal System…
A: Introduction The human body has 11 distinct systems, collectively referred to as organ systems,…
Q: Why should it make sense that a mitochondrion(a cellular organelle) is larger than a phospholipid…
A: Mitochondria (singular: mitochondrion) is the cell organelle that involves production of energy in…
Q: 3. What is ductus choledochus? What is the function of this part? 4. Which part of the…
A: INTRODUCTION Pancreas This is the organ that produce enzymes for digestion. Trypsin and chymotripsin…
Q: efine hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: In the body, hormones act as messengers. Endocrine glands release these substances. In order to keep…
Step by step
Solved in 2 steps
- A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What is the chance that this couple will have a child with two copies of the dominant mutant gene? What is the chance that the child will have normal height?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. Should the parents be concerned about the heterozygous condition as well as the homozygous mutant condition?As it turned out, one of the tallest Potsdam Guards had an unquenchable attraction to short women. During his tenure as guard, he had numerous clandestine affairs. In each case, children resulted. Subsequently, some of the childrenwho had no way of knowing that they were relatedmarried and had children of their own. Assume that two pairs of genes determine height. The genotype of the 7-foot-tall Potsdam Guard was A9A9B9B9, and the genotype of all of his 5-foot clandestine lovers was AABB. An A9 or B9 allele in the offspring each adds 6 inches to the base height of 5 feet conferred by the AABB genotype. a. What were the genotypes and phenotypes of all the F1 children? b. Diagram the cross between the F1 offspring, and give all possible genotypes and phenotypes of the F2 progeny
- A pedigree analysis was performed on the family of a man with schizophrenia. Based on the known concordance statistics, would his MZ twin be at high risk for the disease? Would the twins risk decrease if he were raised in an environment different from that of his schizophrenic brother?Mike was referred for genetic counseling because he was concerned about his extensive family history of colon cancer. That family history was highly suggestive of hereditary nonpolyposis colon cancer (HNPCC). This predisposition is inherited as an autosomal dominant trait, and those who carry the mutant allele have a 75% chance of developing colon cancer by age 65. Mike was counseled about the inheritance of this condition, the associated cancers, and the possibility of genetic testing (on an affected family member). Mikes aunt elected to be tested for one of the genes that may be altered in this condition and discovered that she did have an altered MSH2 gene. Other family members are in the process of being tested for this mutation. Once a family member is tested for the mutant allele, is it hard for other family members to remain unaware of their own fate, even if they did not want this information? How could family dynamics help or hurt this situation?Mike was referred for genetic counseling because he was concerned about his extensive family history of colon cancer. That family history was highly suggestive of hereditary nonpolyposis colon cancer (HNPCC). This predisposition is inherited as an autosomal dominant trait, and those who carry the mutant allele have a 75% chance of developing colon cancer by age 65. Mike was counseled about the inheritance of this condition, the associated cancers, and the possibility of genetic testing (on an affected family member). Mikes aunt elected to be tested for one of the genes that may be altered in this condition and discovered that she did have an altered MSH2 gene. Other family members are in the process of being tested for this mutation. Is colon cancer treatable? What are the common treatments, and how effective are they?
- Achondroplasia is a rare dominant autosomal defect resulting in dwarfism. The unaffected brother of an individual with achondroplasia is seeking counsel on the likelihood of his being a carrier of the mutant allele. What is the probability that the unaffected client is carrying the achondroplasia allele?Mike was referred for genetic counseling because he was concerned about his extensive family history of colon cancer. That family history was highly suggestive of hereditary nonpolyposis colon cancer (HNPCC). This predisposition is inherited as an autosomal dominant trait, and those who carry the mutant allele have a 75% chance of developing colon cancer by age 65. Mike was counseled about the inheritance of this condition, the associated cancers, and the possibility of genetic testing (on an affected family member). Mikes aunt elected to be tested for one of the genes that may be altered in this condition and discovered that she did have an altered MSH2 gene. Other family members are in the process of being tested for this mutation. Seventy-five percent of people who carry the mutant allele will get colon cancer by age 65. This is an example of incomplete penetrance. What could cause this?FAlpQLSfiOhfAvlhxzCSiUll_6rt-nU5b0WI73UmWOxkOw8OCwk01ng/formResponse B 1 2 Bb x Bb b 4 The fur in both parents in this cross is * 1 B B Bb x Bb b 3 4 brown black O homozygous dominant homozygous recessive 3. 近
- In this case a family history revealed a genetic basis for the disorder. The pedigree is shown in Fig. 1 Below. Key Ø Female: affected Female: unaffected || IV V 5600 orize 077808 15 10 9 10 CHO વ Male: affected Male: unaffected Deceased Disease status not given Dizygotic twins Monozygotic twins Fig. 1 Disease pedigree. Five generations I, II, III, IV, V are shown. Females are represented by circles, males by squares, dizygotic (non-identical) twins by diagonal lines originating from the same point, Monozygotic (identical) twins by diagonal lines originating from the same point and joined symbols and deceased by a diagonal line through the symbol. Filled symbols indicate that the individual displays the disease phenotype. Unfilled symbols indicate that the individual does not display the disease phenotype. Carriers of the disease are not indicated. Information on disease status is not known for generation I and is omitted for the individuals represented by a symbol with an asterisk.…A rara autosomal dominant disease is known to have 80% penetrance. If individual II1 has a child, what is the probability that this child will show the symptoms of this disease? II 20% 40% 50% 80% 000015 1 point What is the most likely mode of inheritance of the disease depicted in the following pedigree? ||| IV 1 autosomal dominant autosomal recessive 2 N 1 2 2 3 3 4 3 4 5 --D