In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.

In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The text has discussed the RNA-Seq technique, whichquantifies the amounts of mRNAs present in a given celltype at a given time. We have also described the methodof ribosome profiling, which quantifies the levels ofmRNA sequences that are being translated actively in acell population at a given time. But even when bothkinds of experiments are performed, the data do not tellus accurately the relative amounts of the protein products of these mRNAs in the cells at that time. Why not?What elements of gene expression do these techniquesaccount for and what elements do they ignore?
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
The human α-tropomyosin gene is alternativelyspliced to produce different forms of α-tropomyosinmRNA in different cell types (Figure Q6–3). For all forms ofthe mRNA, the protein sequences encoded by exon 1 arethe same, as are the protein sequences encoded by exon10. Exons 2 and 3 are alternative exons used in differentmRNAs, as are exons 7 and 8. Which of the following state-ments about exons 2 and 3 is the most accurate? Is thatstatement also the most accurate one for exons 7 and 8?Explain your answers.A. Exons 2 and 3 must have the same number ofnucleotides.B. Exons 2 and 3 must each contain an integral num-ber of codons (that is, the number of nucleotides dividedby 3 must be an integer).C. Exons 2 and 3 must each contain a number ofnucleotides that when divided by 3 leaves the sameremainder (that is, 0, 1, or 2).
Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA, singlestranded (1)DNA, single-stranded (2)DNA, singlestranded (1)RNA, and single-stranded (2)RNA.
You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had anticipatedcounting the number of reads of each mRNA to deter-mine the relative abundance of different mRNAs. But youare puzzled because many of the mRNAs have given youresults like those shown in Figure Q8–4. How is it that dif-ferent parts of an mRNA can be represented at differentlevels?
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.