Answered: If you map two different organims daily…

If you map two different organims daily movements, and see these types of patterns, answer the following: B Which animal is likely using piloting to move around the area?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter33: Sensory Perception

Section: Chapter Questions

Problem 6SQ: Mechanoreceptors in the ___ send signal, to the brain about the body's position relative to gravity....

See similar textbooks

Related questions

Q: Ch. 5: Which of the following is FALSE about tuberculosis? a) it is caused by a bacterial infection…

A: Introduction A contagious infectious bacterial disease having its main target area as the lungs. The…

Q: Would a metabolic rational for a child who has a similar diet to other children but after infections…

A: Diabetes is a chronic disorder that occurs due to the reduced amount of insulin or resistance to…

Q: This bacteria is commonly found in soil and water, and can cause otitis externa (aka swimmers ear).…

A: Introduction:- Bacteria are the prokaryotic organisms that causes various types of infections or…

Q: Name the cells in the islets of langerhans which make glucagon and summarize the principles and…

A: The generation and release of hormones that control blood glucose levels is carried out by a group…

Q: why are the color and consistency of cooked meat different than that of raw meat? a.) the…

A: The term "meat" refers to the flesh portions of animals used for nourishment. Such portions comprise…

Q: The nucleic acid of a virus is

A: A virus is a submicroscopic infectious agent that replicates only inside the living cells of an…

Q: What best explains the mechanism of old (and wicked dangerous) diet pills that acted as an…

A: Diet pills mainly act on metabolism and respiration to reduce the amount of energy and calories so…

Q: A. In the above diagram, which part of the ATP molecule contains energy. B. Why does ATP contain…

A: ATP or Adenosine Triphosphate is the chemical energy molecule that provides energy to chemical…

Q: The protein p53 is activated by a number of stresses on the cell, including DNA damage (as shown in…

A: Introduction:- Cancer or malignancy is defined as the abnormal growth of cells. The abnormal growth…

Q: 5. Carbohydrate metabolism involves glycolysis, the Krebs cycle, and the electron transport chain.…

A: Carbohydrates are macronutrient which are present in food and act as main source of energy There…

Q: The fraction 50/53 is not a/an: Ate wedding cake? Yes No Total O b. Ill 50 4 54 Well 3 22 25 Select…

A: In the fraction 50/53, Numerator is the number of Ill individuals who ate cake and denominator is…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: Explain the mechanisms for which the leaf water potential would be more negative at midday than at…

A: Water potential is defined as the potential energy of water in a system compared to pure water, when…

Q: Which of the following will be found is found in mice cells and prokaryotic cells? Select one: a.…

A: Introduction Eukaryotic cells contain the membrane-bound organelles such as the nucleus and…

Q: AT =C/G B. Quantitative geneticists are interested in identifying the number of genes contributing…

A: A) DNA is grouped into nitrogeneous bases called purines and pyrimidines, Purines are Adenine (A)…

Q: Tight juctions _________ Select one: a. prevent cytoplasm from moving b. prevent microtubules from…

A: Tight junctions are formed as a barrier between two epithelial cells. That is they seals down both…

Q: 23. If the foramen ovale remains open after birth the blood between these two areas can mix a) Right…

A: Introduction The thick central layer of the heart is made up of cardiac muscle (also known as…

Q: Ch. 5: Which of the following is FALSE of laryngitis? a) it is due to infection of the epiglottis b)…

A: When the epiglottis, a tiny cartilage "lid" that covers the windpipe, expands, it is said to have…

Q: Short Answer 3. The pedigree shown is of a family with an X-linked recessive disease. The sex…

A: A. Nondisjunction can happen during the anaphase of mitosis, meiosis I, or meiosis II. Sister…

Q: explain the concept of global gag rule

A: The Mexico City policy, often known as the worldwide gag rule, is a harmful anti-abortion measure…

Q: Pictured below is a food web. Each letter is a species. In order to observe top-down control, which…

A: An important characteristic of an ecosystem is the populations of various species in each trophic…

Q: Which of the following represents the fraction of carrying capacity remaining after a certain number…

A: What is carrying capacity? The carrying capacity of a population is the maximum number of…

Q: Ch. 8: Which of the following is UNLIKELY to improve the symptoms of premenstrual syndrome? a)…

A: Premenstrual syndrome (PMS) is a collection of physical and emotional symptoms that occur in the…

Q: Provide a review of related study on the use of calamansi rinds extract as an alternative to…

A: Calamansi rinds extract is a natural extract derived from the rinds of the calamansi fruit. It is a…

Q: diagram modeling the pathway by which a nitrogen atom in a protein in a bird can become…

A: Introduction the formation of protein in plants by absorbing nitrogen from the animal and bird…

Q: Mitogens tend to ___________ Select one: a. suppress cell division b. promote cell division c.…

A: The process by which a parent cell divides into two daughter cells is known as cell division.…

Q: (no) 8. A manx mouse with blue fur is crossed to a long-tailed, black mouse heterozygous for color.…

A: Let the dominat allele for black fur be denoted as B and recessive (blue) as b. Aslo, let dominant…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly Mutant 1: Met Ser Pro After pro, the peptide…

Q: 14. Which of the amino acids below donates an ammonia group to every molecule of urea? a. Serine b.…

A: We all know that there is a continuous urea cycle occuring in our body.Some amino acids are also…

Q: Black Plague is caused by a..... protozoan (protist) Obacterial Oprion O fungus O virus

A: What is plague? A plague is an infectious disease, which is caused by the bacteria Yersinia pestis.…

Q: Explain the intracellular pathways) calcium channel blockers in regards tot he heart. Give…

A: A class of organic chemical compounds known as calcium-channel blockers has the ability to prevent…

Q: summarize briefly clinical homeostatic imbalance , disoreders of ANS?

A: Introduction A stable, relatively constant internal environment is maintained by the tendency of the…

Q: What prevents the lakes of colder parts of the world from freezing solid from bottom up? Water in…

A: Warm water generally gets more dense as it gets colder, and therefore sinks. This fact may lead you…

Q: Ch. 6: The laboratory sends you these ABG results for your patient: pH 7.32, PaCO2 40 mmHg, and…

A: INTRODUCTION ABG Analysis This is arterial blood gas analysis. It measure the amount of arterial…

Q: Which of the following reflects sequence elements conserved in pre-mRNA splice sites? (more than one…

A: Several operational mRNAs can be produced from a single transcript that codes for multiple proteins…

Q: Regulation of gene expression most typically occurs at the level of ______________. Select one:

A: DNA is the nucleic acid serving as the genetic material of almost all living entities except a few…

Q: Mutations were introduced into a type I receptor of steroid hormone X. Two classes of mutants were…

A: Gene expression under the hormonal influence means that the when the hormone binds to its receptor…

Q: 18. You created a transgenic mouse in which all B cells express heavy and light chain of…

A: Transgenic mouse is a kind of mouse which is created artificially by genetic engineering that is by…

Q: The chromosomes in the illustration below are found in a male betta fish and carry the gene for…

A: Mendel proposed the laws of inheritance based on the results of his hybridization experiments. He…

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: 29. Correctly label each image below with the ELISA method it is describing (3pts) Ag Ampan…

A: Introduction:- ELISA is a plate based assay technique designed for detecting and quantifying soluble…

Q: Which of the following is a function of this nucleotide: 3' H O 011-0 0 Guanine H OH O Acts as a…

A: Solution :- A nucleotide is an organic molecule with a basic composition of a nitrogenous base,…

Q: Assuming each dimer binds to one unique sequence, how many unique sequences can protein dimers…

A: Proteins are biomolecules, which are made from amino acids. They are polymers of amino acids. They…

Q: Give 4 similarities and 4 differences between and nature and/or role of membrane potentials in a…

A: The mitochondrial membrane potential (m) generated by proton pumps controls how energy is stored…

Q: true or false: DNA polymerase I is the main polymerase enzyme involved during elongation.

A: DNA polymerases belong to a group of enzymes that catalyzes the synthesis of DNA during replication.…

Q: You would like to design a method to treat the most common mutation that causes sickle cell anemia…

A: The Cas9 gene and the guide RNA are the two essential components needed for a CRISPR/Cas genome…

Q: 1. DNA replication is A. Conservative B. Semiconservative C. Dispersive D. A combination of the…

A: 1. In DNA replication, each strand of a double stranded DNA act as a template which synthesizes a…

Q: Contrary to Jean Piaget's assertions, research using infant looking time demonstrates that even 3-…

A: An experiment is performed using several factors that are called variables. Depending on their…

Q: microRNAs degrade ______________ and is an example of __________ regulation. Select one: a. DNA,…

A: Introduction and answer • A microRNA (miRNA) is a 21-24 nucleotide (nt) dsRNA.• Small RNA that is…

Q: N) What is the expected number of double-recombinant offspring? O) Why is the expected number not…

A: During formation of gametes, there is a stage where diploid cell converts into haploid. Each gametes…

Concept explainers

Human Movement

Humans can move from one place to another through coordinated movements and postures. The movement produced by the human body due to the contraction of muscles and bending of bone joints is called human movement. Human movements are controlled by the nervous system. Hence, the human movement incorporates the use of muscles, ligaments, joints, and bones. Kinesiology is the field that deals with the study of human movements.

Question

100%

If you map two different organims daily movements, and see these types of patterns, answer the
following:
B
Which animal is likely using piloting to move around the area?
B

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

Final answer

Explanation

Conclusion

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe how animal body plans influence movement. Give examples.
Considering animals with a body mass of about 100 g, rank thethree forms of locomotion from highest energy cost to lowestenergy cost. Were these the results you expected, based on yourown experience? What could explain the energy cost of runningcompared to that of flying or swimming?
What is meant by dynamic equilibrium? Why would it bewrong to say homeostasis prevents internal change?
Log observations on the feeding behavior of the cockroach in Ta ble 1. Note of the sensory input &motor output corresponding with the behavior of feeding. Sensory input is anything perceived by the senses; the stimuli perceived by the organism like olfactory, visual, mechanoreception, gustatory, & hearing. Motor output results after the nervous system integrates & processes the sensory input. It synthesizes sensory input to compute an appropriate motor response like leg extension etc.
Although some sharks close their eyes just before they bite,their bites are on target. Researchers have noted that sharksoften misdirect their bites at metal objects and that they canfind batteries buried under sand. This evidence suggests thatsharks keep track of their prey during the split second beforethey bite in the same way that(A) a rattlesnake finds a mouse in its burrow.(B) an insect avoids being stepped on.(C) a star-nosed mole locates its prey in tunnels.(D) a platypus locates its prey in a muddy river.
give a sample scenario of Stimuli - Suppresion
An owl swoops down when it sees prey. In this scenario, what is the stimulus and what is the response?
Describe how a snake moves by lateral undulation. Why might this form of locomotion be inefficient on an unstable surface (such as sand) or a surface lacking irregularities? What forms of locomotion would work for a snake under these conditions?
Give further examples of animal movement and its applications, such as in ants, lizards, and earthworms. Give an example on how our body uses the pairing of stimulus and response
According to the video, what is one adjustment and one adaptation living in high-altitude environments? Video - https://youtu.be/elOn5ZYg5fc
How do po Inwole erit saob wol nk about the benefits of studying animal behavior and ecological interactions WITHOL erference by human observers. Describe at least 2 benefits. A. YOU Ispipe 1sdW B. ctions: As a class we will watch the following videos. As we watch the videos er the questions below. dals Google search: "Fish Thieves Take Rare Seals' Prey" and click on the first Direct Link: http://video.nationalgeographic.com/video/monk-seal-ani a. The monk seal dives 80m (262 ft) down into the ocean to do what? Why? girlenoitslen iso loos to brix t affected Synw
If an egg rolls out of the nest, a mother greylag goosewill retrieve it by nudging it with her beak and head.If researchers remove the egg or substitute a ball duringthis process, the goose continues to bob her beak andhead while she moves back to the nest. Explain how andwhy this behavior occurs.