If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the coding region, what is the most likely Second letter result? UCU UCC UCA UUG Leu UcG UUU Phe UAU UAC Tyr UGU Cys UGC UAA Stop UGA Stop UAG Stop UGG Trp G UC Ser UUA CUU CAU CAC CCU CGU CGC CGA CỤC Leu CCA CUA CCC Pro His CAA Arg CUG CAG Gin CCG CGG AUU ACU AAU) AAC Asn AGC Ser Thr AAA1 AAG Lys AGG Arg AGU AUC lle ACC AUA ACA AUG Met ACG AGA GCU GCC GCA GUU GAU) GAC Asp GGC Ala GGU GUC Val G GUA GAA1 GGA Gly Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. no protein is made no effect protein has altered amino acid sequence protein is not made because of frameshift mutation Third letter First letter

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…

A:

Q: You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence:…

A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…

Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE)  DNA GTG TAC GAA CGT mRNA         Amino Acid

A: MC1R gene  It provides instructions for making a protein called the melanocortin 1 receptor. This…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A:

Q: If there are multiple start condo, how can you identify the real start codon? By observing Okazaki…

A: Transcription and translation are specialized events that are part of the central dogma i.e. DNA to…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: RNA sequence of A gene       If we have the following mutations, find the type of the mutation…

A:

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The gene comprises the…

Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…

A: As required, only E and F has been answered.

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: A nonsense mutation occurs in the AB sequence. What would be the most significant outcome of this?

A: Metabolic pathways- Metabolic pathway is a linked series of chemical reactions occurring within a…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: A portion of the coding sequence of a cloned gene is shown…

A: The process of converting a DNA strand into mRNA is known as Transcription. The strand having the…

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: A eukaryotic gene typically has all of the following features except O A5' UTR An operator O A…

A: Eukaryotic genes are regions of DNA that act as templates for the production of RNA by RNA…

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…

A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: A protein has the following amino acid sequence:…

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: If you were to look at other CRISPR’d mutants with 1-2 nt deletions, you would see the position of…

A: CRISPR system is mostly present in bacteria and archaea. This system uses the small RNA to find the…

Q: Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition;…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine (A…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: 1. Below is the sequence from the 3' end of an mRNA.…

A: Genes store genetic information in the form of DNA, which may be converted into functional proteins…

Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Q: A mature transcr Select one: a. 5' UTR b.introns С. ехons O d. Poly A ta e. guanine f.3' UTR

A: The 5′ untranslated region is the region of an mRNA that is directly upstream from the initiation…

Q: In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be…

A: Most of the amino acids are encoded by two or codons, which shows nonambiguity, and that code is…

Q: ATTTGAGCC- Original ATTGAGCC - Mutated   The example above is an example of a  Nonsense Deletion-…

A: Any detectable , inheritable qualitative or quantative change in genetic material of an organism not…

Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: You have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene…

A: Cystic fibrosis is a disease in which there is  excess mucus productions in the body such as lungs…

Q: Below is a portion of an exon from a gene that encodes protein X in the genome of the plant…

A: We have DNA which codes all the genetic information. It is made up of four bases that makes…

Q: You are studying a gene containing three exons (exon 1 = 66 nucleotides , exon 2 = 99 nucleotides ,…

A: One strategy that can be used here is alternative splicing where different combinations of exons…

Q: please only answer part d and e

A: Cystic fibrosis is an autosomal recessive disorder, which affects lungs, digestive system and other…

Q: What is the complementarity rule that governs the synthesis of an RNA molecule during transcription?…

A: Complementarity is a property according to which two DNA or RNA strands bind with each other or new…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: The following is a section of the gene coding for bovine rhodopsin along with several restriction…

A: Restriction endonucleases  is a bacterial enzyme which cuts DNA strands in to fragments after…

Q: A protein has the following amino acid sequence:…

A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.