Q: What is copy-number variation? How does it arise?
A: It has been analysed that there is an unexpected variability in the individual human genomes. This…
Q: What is the genetic premises
A: A scientific premise can be defined as the knowledge that is gained based on the hypothesis and…
Q: What is an inactive gene?
A: A gene is a set of nucleotides that codes for a particular protein. Gene is functional unit of…
Q: What is a Nucleoid made of?
A: A nucleoid is found inside a prokaryotic cell. Prokaryotes are a microscopic unicellular organism…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: How are two topoisomers different from each other? How are theythe same?
A: The group of isomers that have the same molecular formula, stereochemical bond connections and…
Q: Is a gene a triplet ofconsecutive DNA nucleotides?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: each member of the gene pair come from?
A: Diploid organisms have a pair of genes
Q: What is an imprinted gene
A: Imprinted genes are genes that violate the usual rule of inheritance. Their expression is determined…
Q: What is a gene family? How are gene families produced over time?With regard to gene function, what…
A: Gene is known to be a hereditary unit. They are composed of DNA or deoxyribonucleic acid and some of…
Q: If circular B-DNA is positively supercoiled, will these supercoils be left- or right-handed?
A: Supercoiling of DNA is a biological process that regulated the unwinding and rewinding of the DNA…
Q: What are the function of single nucleotides polymorphism?
A: Single Nucleotide Polymorphisms(SNPs) is the single nucleotide which occurs at the specific position…
Q: What are long interspersed elements (LINEs) ?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Besides H1, how many different kinds of proteins are part of the nucleosome?
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: In a numeric pyramid,is it possible the base to be smaller than the other levels?
A: A pyramid of numbers or numeric pyramid shows the total number of individual organisms at each level…
Q: What makes the deletion of a gene?
A: Deletion is a type of mutation in which a part or sequence of a chromosome that can be a single base…
Q: What is terminal deletion in genetics?
A: A single break may cause terminal deletion; but, due to the need for specific chromosome tips…
Q: Why is the Nucleoid important?
A: The nucleoid is an irregularly shaped structure present in prokaryotic cells . It does not have any…
Q: What does the White gene code for?
A: Genes are the structural and functional units of heredity that carry coded genetic information in…
Q: what is structural gene and what is non-structural gene? what is the differences between them?
A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…
Q: What is a gene family?
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: The number of Chromosomes in the human gene is ___.
A: The chromosomes are thread-like structures that carry genetic information. They are made up of DNA…
Q: What is a gene? Provide at least two different definitons and explain.
A: DNA contains gene that has genetic information and passes to the next generation. The functional…
Q: Which are enzymes that shorten the poly-A tail ?
A: Cytoplasmic PABP2 is having some canonical functions. Along with this, it also induces poly(A)…
Q: What is the function of histones?
A: Chromosomes are thread-like structure situated inside the nucleus of plant and animal cells. Each…
Q: How many types of histones and non histone are there?
A: Histones are highly basic proteins present in the eukaryotic cell nuclei. They pack and order the…
Q: What is the function of histone?
A: The folding of the DNA molecule into a compact, orderly structure that fits into the limited space…
Q: centromeres consist which two sequences?
A: Centromere is the region in a chromosome that connects the sister chromatids together. Chromosome is…
Q: Why might the locations of introns and exons be the same in both alpha- and beta-hemoglobin genes?
A: Exons are conserved DNA and RNA nucleotide sequences that play a role in the production of mature…
Q: What are the penetrance and the expressivity of a gene?
A: In some cases, individuals who have the same genotype do not display the same phenotype in exactly…
Q: What mutagen results to the formation of thymine dimers?
A: Asked : Mutagen which results to the formation of thymine dimers
Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…
A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…
Q: What is a microdeletion?
A: Chromosomes are structures present in the nucleus of the cell. The chromosomes are formed of DNA…
Q: Is an ORF a gene?
A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…
Q: What is the physical structure of a gene?
A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome is…
Q: Besides the size and position of the centromere, what is the same about these?
A: *Chromosomes are thread like structures located inside nucleus which is made of protein and a…
Q: What are geneticmutations?
A: A gene is a sequence of nucleotides in genome that codes for a functioning molecule. There is…
Q: Why Some hypermorphic alleles encode overactiveproteins?
A: A mutation is any alteration in the sequence of DNA. It may be caused due to error in replication or…
Q: What mechanism generates a gene family?
A: Gene family is a set of many similar gene. An example of gene family in humans is the genes for…
Q: What are the histone types found in the octamer wrapped by DNA strands?
A: Introduction: The DNA is wrapped around the histone protein, and the structure formed is called a…
Q: What chemical component of the chromosome makes up genes ?
A: The cells have many organelles. Each organelle is involved in a specific function. The nucleus of…
Q: What is the function of the nucleoid in a bacterial cell?
A: The cell is the basic structural and functional unit of the body in all organisms. Cells are…
Q: What are genetic laws
A: Genes, genetic diversity, and heredity in living things are all studied in the branch of biology…
Q: How can a single gene encode multiple versions of a protein?
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: How many genes are there in a human cell .
A: Genetic material refers to the hereditary material found in the cells of all living things. It is…
Q: How much of the genetic coding of an organism is contributed by each parent?
A: Genetic code can be defined as the term that is utilized the way that the four bases of DNA--the A,…
Step by step
Solved in 2 steps
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ 1. For the second, third, fourth, and fifth codons, write all possible anticodon sequences (left-to-right, 5’- 3’), including anticodons with wobble and inosine.Describe the structure of nucleosome ( please keep it short as much as you can ) .
- If you are given four nucleotides, how many possible combinations of five letter codons will you have? 16 64 256 54 1024What do you mean by lysozyme gene?According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain? O 20% O 30% O 606 O none of the above
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________What is meant by the statement “The genetic code is universal”? What is the significance of this finding?The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
- Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.Why is rRNA so suitable for determining relatedness?The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…