Q: 2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…
A: Introduction Deoxyribonucleic acid, also known as DNA, is the molecule that carries the genetic…
Q: 3c. there are three enzymes that go by the name of DNA polymerase 1 2 and 3. please describe the…
A: DNA polymerase helps in the synthesis of new strand of DNA. DNA polymerase is present in both…
Q: If the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell…
A: DNA packaging is done in order to fit the linear DNA molecule inside the nucleus. Is starts when DNA…
Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…
A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…
Q: 26. Directions: 1st Fill in the complimentary DNA strand using DNA base pairing rules. 2nd Fill in…
A: Reverse transcriptase, a DNA polymerase which can use either DNA or RNA as a templates, creates…
Q: What's the length of the DNA around histone core in a nucleosome? 50 base pairs 146 base pairs 8…
A: Nucleosome:- Histones are responsible for the first level of DNA packing and most basic level of…
Q: The DNA molecules in eukaryotes including humans are negatively supercoiled while that in…
A: Genetics is a part of science worried about the investigation of qualities, hereditary variety, and…
Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…
A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…
Q: State five differences between DNA replication, and transcription in eukaryotes.
A: Note: Since you have posted two unrelated questions, we are solving the first one for you. If you…
Q: 3 genetic diseases that have been resolved by genetic engineering.
A: a. Xeroderma Pigmentosum: It is an autosomal recessive disorder that is characterized by severe…
Q: 3 features of DNA markers
A: DNA markers are basically the fragment of the portion of the DNA whose location as per the genome is…
Q: b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of…
A: Replication It is defined as the process in which the DNA duplicates into another copy which is…
Q: Which one is correct about telomeres? Choose at least one correct answer TTAGGG sequence is…
A: The distinctive structures that are found at the ends of our chromosomes and consist of the…
Q: The Eukaryotic Chromosome Consists of a Linear DNA Double Helix Bound to Proteins
A: The DNA helix is wrapped around proreins to form Nucleosomes.
Q: enerations, what must be true about the mutation?* OIt must occur during the first stage of DNA…
A: Mutations are the abrupt change in the nucleotides of the DNA which may prove harmful as well as…
Q: what are we looking at in part (b)? Is this an11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does…
A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…
Q: 14, the extrachromosomal DNA in bacteria is A. called plasmid and found in all bacteria B.…
A: Introduction Extrachromosomal DNA is any DNA that is found off the chromosomes, either inside or…
Q: Explain why DNA replication proceeds only in the 5′ to 3′direction.
A: DNA replication is the process through which two identical DNA molecules are produced from a…
Q: 34. Chromatin is composed of roughly equal amounts of DNA and proteins called histones. Nucleosome…
A:
Q: In nucleosomes, DNA wrapped around octamar of histone proteins O False True
A: A histone octamer is the eight protein complex found at the focal point of a nucleosome center…
Q: 17.What is something you found interesting about the connection between mitosis and cancer? Explain…
A: 17) Mitosis is the important cell division that takes place in our body. Mitosis is responsible for…
Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…
A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…
Q: How many subunits does E. Coli DNA polymerase I have? 5 10 1 3
A: The DNA polymerase I helps in replication,repair and recombination of DNA. E.Coli has 5 sub units of…
Q: The replication of chromosomes by eukaryotes occurs in a relatively short period of time because ?…
A: The DNA replication is the production of new DNA from the old DNA by the semiconservative manner. In…
Q: Answer the following four questions about DNA and chromosomes. (Hint: there may be slightly…
A: Deoxyribonucleic acid (DNA) It is one of the genetic material which have two polynucleotide chains.…
Q: Pinker mentions that only 1% of the human genome codes for proteins (the rest included introns,…
A: In humans, the complete set of nucleic acid sequences is referred to as the human genome. It is…
Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…
A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: 48. The nuclear membrane is still intact to protect the DNA molecules from undergoing mutation A.…
A: Introduction Cell division:- It is the process by which cells divide and increase in number to…
Q: X-rays strike a chromosome in a living cell and ultimately cause the cell to die. Did the X-rays…
A: Introduction Radiation such as X rays are harmful to the mankind, they have high energy value and…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: During DNA replication, the double stranded DNA molecules are separated into single strands and…
Q: 1. What cellular process is shown at the right? 2. If adenine is located on strand 4, then what…
A: DNA Replication is a complex process that requires the presence of many factors and enzymes to begin…
Q: Telomerase is a very important enzyme for the control of both cancer and aging. In 5 sentences,…
A: The ends of the linear chromosome is known as telomere,it is rich in the tandem repeats of…
Q: 1 5' AGT C CGAUGC3' 10 8. There are inaccuracies in the DNA molecule shown here. a) Name three…
A: Introduction : DNA is known as deoxyribonucleic acid and the nitrogen bases present in it are…
Q: In your own words, explain how cancer cells differ from normal cells in regard to the following:…
A: The ends of a chromosome are known as telomeres. These are regions that do not code for the DNA in…
Q: State 3 simple ways in which RNA polymerase is the same as DNA polymerase.
A: A polymerase is an enzyme, which synthesizes long chains of polymers or nucleic acids.…
Q: 28. In eukaryotic cells A All DNA is packaged into chromasomes C. Most 8. Some D. Rare
A: Introduction Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: A brief discussion on human chromosomes both male and female 2. Explain the difference between…
A: Chromosome is found in the nucleus of cells and carries genetic information. Only first question out…
Q: 1. In adults, these DNA regions would contain the genes for hemoglobin. a. euchromatin b.…
A: Chromatin can be defined as a complex threadlike structure made up of DNA and proteins found in…
Q: 1. An embryo replicates its DNA every 5 minutes. What is the maximum distance that origins of…
A: Replication is duplication process requiring copying from a template. It occurs in case of DNA.…
Q: Shows a nucleosome with DNA (wire structure) wrapped around the outside. Where would you look for…
A: A nucleosome is a piece of DNA that is wrapped around a protein core. DNA creates a compound with…
Q: 12. A diagram of DNA replication is shown below. Redraw the diagram into copybook and fill in the…
A: DNA replication: a. During DNA replication, an exact copy of DNA is made from the template strand.…
Q: Many cancer cells are immortal and can be cultured in the laboratory for many years. Many of these…
A: Introduction The aging of cells can be attributed to several factors such as degradation of…
Q: Chromosomes contain- (A) Protein only (B) DNA and protein (C) DNA, RNA and histone (D) DNA, RNA,…
A: Introduction - DNA is bundled into thread-like structures called chromosomes in the nucleus of each…
Q: 1. The four core histones are relatively small proteins with a very high proportion of positively…
A: Histone proteins are tiny structure that are made up of 8 proteins and are safely stored inside the…
Q: In eukaryotic chromosomes, DNA wraps around_____ . a. histone proteins d. centromeres b. sister…
A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C…I need help with a biology question...... A single polypeptide is specified by a single_______________ gene nucleotide chromosome codon
- It’s likely that mutation affects Prokaryotes more than Eukaryotes. 1. Can you think of why that might be?Question 1 I . Protein Synthesis – complete the chart for this coding region of a gene. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acidDemuestra lo que sabes del vo X ure.com/courses/57129/quizzes/206819/take Question I8 1 pts 3.7- Chargaff's Rule & The Hayflick Limit In 1950, Erwin Chargaff analyzed the base pair composition of DNA. He discovered that... % Adenine = % Thymine % Cytosine = % Guanine Meaning... There are equal amounts of Adenine and Thymine and equal amounts of Cytosine and Guanine in any given DNA sample. Question: Which of these statements is TRUE if there is 40% Guanine in a strand of DNA? There is 20% Adenine O There is 15% Thymine O There is 10% Cytocine O There is 10% Adenine
- This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got about answering the question? (I do have the Codon table in my textbook) Consider a hypothetical protein that consists of the amino acid sequence arginine, phenylalanine and histidine. From this information, construct (1) the original DNA strand, (2) corresponding mRNA codons and (3) tRNA anticodons used to produce this hypothetical protein. (Only use 1 mRNA codon per amino acid.) In addition, be sure to include start and stop sequences where appropriate.Could you please help me with the following questions? I am struggling tremendously. Thanks so much! Why are cell membranes disrupted by soap? Some organisms can live in hot springs. What does this imply about their DNA?ANSWER THE FOLLOWING QUESTIONS COMPLETELY 1. Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a. Fixed protein products b. Functional protein products c. Nascent polypeptide chains d. Variable protein products 2. How are incorrect base pairing during replication determined by DNA repair machineries? a. Bulges in the newly synthesized strands due to absence of complementary strands b. Fragments in the newly synthesized daughter DNA strands due to faulty ligase action c. Kinks in the daughter DNA strands due to non-pairing of non-complementary bases d. Supercoiling of DNA strands due to release of single strand binding protein molecules 3. A four-year old who easily tires and has trouble walking is diagnosed with Duchenne muscular dystrophy with an abnormal promoter region of the affected gene. Which would be the most likely effect of this abnormality in the expression of the gene? a. Capping of the transcript is defective b.…
- Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.5. Von Gierke's disease results from the lack of glucose-6-phosphatase (G6Pase) activity. This causes an increase concentration of glucose-6-phosphate. One of the effects of this disease is gout. Describe how elevated levels of glucose-6-phosphate would lead gout. I ÍI.- --- 6. Replication is the process by which we replicate DNA. This process requires the two strands of DNA to be separated in order for replication to occur. How does having the DNA underwound help facilitate the separating of the DNA strands?