Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?

Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?

Name: Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 70
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the avera

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Mammals contain a diploid genome consisting of at least 109 bp. If this amount of DNA is present as chromatin fibers, where each group of 200 bp of DNA is combined with 9 histones into a nucleosome and each group of 6 nucleosomes is combined into a solenoid, achieving a final packing ratio of 50, determine (a) the total number of nucleosomes in all fibers, (b) the total number of histone molecules combined with DNA in the diploid genome, and (c) the combined length of all fibers.
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Pinker mentions that only 1% of the human genome codes for proteins (the rest included introns, regulatory sequences, and repetitive DNA, some of it parasitic—we will talk about this later). Given that the human genome contains 3 x 109 base-pairs of DNA, there are about 20,000 human genes, and three base pairs code for each amino acid in a protein, how many amino acids are in the average human protein? [Hint: start with what fraction of base pairs in the human genome code for proteins.]
Eukaryotic DNA is typically organized into two major regions called euchromatin and heterochromatin. Which of the following applies to euchromatin? They are regions of little or no transcription activity. They are regions of highly condensed chromatin. They are regions that are uncoiled and active in transcription. They may refer to regions near the ends of chromosome (telomeres). They refer to regions that contain the centromere.
The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)
A diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine
Assuming that the histone octamer forms a cylinder 9 nm in diameter and 5 nm in height and that the human genome forms 32 million nucleosomes, what volume of the nucleus (6 μm in diameter) is occupied by histone octamers?
Cell (A) contains 3.1 billion (3.1 x 109) base pairs of DNA. Each nucleosome has about 200 bp of DNAwrapped around the histone core.a. What is the maximum number of nucleosomes that can be present in the cell?b. What is the maximum number of H2A histone protein molecules that can be present in the cell?