Answered: how the theory of evolution affects…

Science

Biology

how the theory of evolution affects ours view of origin,developtment and spread of new diseases such as covid 19?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter19: Evolutionary Change In Populations

Section: Chapter Questions

Problem 15TYU

See similar textbooks

Related questions

Q: Skeletal muscles move as coordinated by the nervous system. sympathetic somatic O peripheral O auton...

A: Skeletal muscles/Voluntary muscles Transverse lines are found at regular intervals. Hence these mus...

Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...

A: Introduction : thermal energy - every objects has thermal energy. It's the movement of molecules w...

Q: 45

A: Steps of Enchondral Ossification Cartilage > Bone Detailed sequence elucidated in part 2

Q: what is the purpose of the nucleous ? - define diploid

A: In biology, a cell is a membrane-bound unit that holds the basic molecules of life and is made up of...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Adrenaline is secreted to stimulate during cold exposure or during heat defense. vasodilation: vasoc...

A: Adrenaline, commonly known as epinephrine, is a hormone that plays a role in visceral function regu...

Q: Mycobacteria tuberculosis and Rickettsia

A: Mycobacterium tuberculosis is a pathogenic that bacteria from the family Mycobacteriaceae and the ca...

Q: Miguel went to the dentist, who performed a procedure that eliminated his tooth pain. The next time ...

A: Answer :- In given case , the consequence for Miguel is negative reinforcement.

Q: What are persistent organic pollutants (РOPS)?

A: Introduction In this question we have to write about the persistent organic pollutants.

Q: State a specific domestic crop and show the evolution with explanation.

A: Crop evolution has followed a multifaceted line of trends as explained below. Wheat is one such dome...

Q: What are cerebrovascular accidents?

A: Introduction In this question we will discuss about the cerebrovascular accident

Q: After conducting the Gram staining procedures and you observe nothing (you didn’t see anything) in y...

A: Introduction Gram staining, commonly known as Gram's method, is a staining technique that is used to...

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' ...

A: The mRNA that is produced by the process of transcription undergoes a modification process in order ...

Q: Which of the following statements accurately describes the pattern of recruitment in a muscle when p...

A: The contraction of muscle is responsible for the development of muscle movement. The generation of s...

Q: Recall p + q = 1 p2 + 2pq + q2 = 1 p is the frequency of t...

A: Hardy-Weinberg law states that in a large population, the gene frequencies of various kinds of genes...

Q: rforming PCR below with 1 as the

Q: You spread a small amount of a water sample from the environment on an enriched media agar plate. Af...

A: A tip of needle contains millions of micro-organisms, with millions of species and having different ...

Q: Which of the following statements indicate the function of growth hormone? It controls and regulates...

A: Hormones are chemical substances that act like chemical messanger molecules in body . They are synth...

Q: What factor could have been responsible for the changes in the population's age structure? Use the s...

A: The population age structure of a country or region is the distribution of its people's ages. This c...

Q: What are the typical features of the age pyramids of underdeveloped countries?

A: Introduction I'm this question we will discuss about the typical features of the age pyramids of und...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: On a fox ranch in Wisconsin, a mutation arose that gavea “platinum” coat color. The platinum color p...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: construct your own mnemonics on the hierarchy of taxonomy. (example: kindly put candy out for good s...

A: Taxonomic hierarchy - it is the process of arranging various organisms into successive levels of the...

Q: Pearl is a 45 year old lady with a history of Bipolar Affective Disorder. In the past ten years she ...

A: Bipolar disorder is a psychiatric disorder in which there is mood swings living between depression a...

Q: (d) Given below is an apparatus used to study a particular process in plants. Study the same and ans...

A: The apparatus mentioned here is used to study the water movement in plant with the help of coloured ...

Q: In your own understanding, Indentify the hurdles that may help to lengthen the shelf-life of squash ...

A: The shelf- life of a product depends upon the condition in which the product is being placed. Better...

Q: If you were studying mutant rabbits which seem unable to sense and move away from a harmful heat sou...

A: Receptors are present on the sensory organ that sends the message to brain via nerves.

Q: Pathogen A has an ID50 of 10 cells and an LD50 of 10,000,000 cells. Pathogen B has an ID50 of 10,000...

A: Given information Pathogen A ID50 of 10 cells LD50 of 10,000,000 cells Pathogen B ID50 of 10,000 ...

Q: A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by bur...

A: Introduction A genome is consisting of transcriptionally active genes. These genes form mRNA as the...

Q: With a dihybrid cross, now many individuals would you expect, out of 16, to show BOTH dominant trait...

A: Introduction:- A breeding attempt between two creatures that are identical hybrids for two traits is...

Q: White trait refers to A. Genotype B. Gene C. Phenotype D. Polygenic Trait 2. All of the followi...

A: Phenotype It is the external and morphological appearance of an organism for a part particular chara...

Q: In which phase are chromosomes not visible? O prophase O anaphase interphase O metaphase

A: Under the microscope, gross changes are not accompained during interphase of cell cycle. In interpha...

Q: Recall p + q = 1 p2 + 2pq + q2 = 1 p is the frequency of t...

A: If the alleles and genotype frequencies remain same in a population generation after generation then...

Q: How are the concepts of "proxy" and "analogy" similar, and how are they used in reconstructions of t...

A: Proxy or equivalent term homologous is a structure inherited from a common ancestor. Analogy or anal...

Q: Meaningful evolution occurs when __________. ○ a heritable trait affects survival and fitness ○ a ...

A: Evolution is the change in the characteristics of a species over several generations and relies on t...

Q: If you could replace all of the plant ATP synthase with ATP synthase enzymes from animal cells, orie...

A: Chemiosmotic hypothesis explains the mechanism by which ATP is synthesized by the ATP synthase compl...

Q: As global average temperature increases, which of the following regions is expected to experience th...

A: Global warming is a phenomenon in which the earth's global temperature is increased due to the emiss...

Q: at are the types of hair

Q: What are the typical features of the age yramids of underdeveloped countries?

A: Definition:- The Age Pyramid is a graphical representation of distribution of populations of a parti...

Q: Describe the specimen and explain how the presence of fossil bacteria supports the idea that the Ear...

A: Answer : specimen is the term used for the sample of anything which is used for testing and which te...

Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

Q: Give the Morphological characteristics of Aedes aegypti adults.

A: Toxorhynchitinae, Anophelinae, and Culicidae are the three subfamilies of the Culicidae family, with...

Q: 13 10 13, ATLAS (caudal view) AXIS (left side) 16 CERVICAL (caudal view)

A: * Turtles reptiles also known as Testudines. *A shell is formed from their ribs. *turtles are divide...

Q: Phases of the Cell Division Cycle What is the correct order of phases in the cell cvcle (start with ...

A: Interphase is made up of three phases: G1 (cell growth), S (DNA synthesis), and G2 (cell division) (...

Q: The following DNA sequence has been identified and named ‘Gene Z’. It is thought that this sequence ...

A: PCR is a polymerase chain reaction, this is a biotechnological process which is used to amplify the ...

Q: (a)Describe the small intestine epithelia cells observed under HPO in microscope. (b) Describe the k...

A: In small intestine mainly simple columnar epithelium and in kidney simple cuboidal epithelium is fou...

Q: 3 What is Polymerase Chained Reaction (PCR)? How does PCR work?

A: The world as a whole saw a surge of the disease COVID in the year 2020. For the detection of the vir...

Q: What is biology

A: Biology deals with living organisms and their various processes. It is a natural science discipline.

Q: 3. What's the difference between chronological age and biological age?

A: Introduction The length of time that someone or anything has lived or existed is referred to as thei...

Q: Which of the following statements about the lac operon is correct? 1. lacZ, lacY and lacA proteins a...

A: Introduction : Lac Operon - Regulatory gene is Lac I . Structural genes are lacZ, lacY and lacA. ...

Concept explainers

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth. Human evolution is an outcome of interaction among the following processes:

Question

how the theory of evolution affects ours view of origin,developtment and spread of new diseases such as covid 19?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

expalin how theory of evolution affects our view of the origin, developtment and spread of new diseases such as COVID 19?
1. Hugo de Vries hypothesized that the characteristics were transmitted via some sort of particle that was given to the offspring by the parents. 2. The particle was dubbed as pangene by Vries. Number 1 is the first statement. Number 2 is the second statement. Both statements are true Only the second statement is truel Both statements are false Only the first statement is true It occurs when a population suddenly gets much smaller. This might happen because of a natural disaster such as a forest fire. genetic drift bottleneck effect founder effect natural selection Who proposed the three kingdom system? * Ernst Haeckel Carl Woese Robert Whittaker Aristotle
I know positive selection is happening but what can we interpret from this evolutionary tree?
The method of applying the molecular clock to determine the timing of the most recent common ancestor of HIV to 1930 was used to.... O 1. Test the hypothesis that HIV jumped from a bat population into humans 2. Test whether HIV was circulating in the human population at the same time as the Spanish Flu influenza A virus O 3. Calculate the divergence time between HIV-1 and HIV-2 O 4. Test whether HIV was spread through a contaminated polio vaccine in the 1950s O 5. Estimate the rate of evolution for all human retroviruses
How does artificial selection, natural selection, genetic drift, mutation and recombination beneficial to the different organisms?
How do I describe evolution of genesv represented by protein sequences?
Do you think a variation in the human genome that confers resistance to coronaviruses (SARS-COV-2) Will be selected for in the human population through future human generations? why or why not? Consider covid 19 morality rates, the reproductive ages of those who are most at risk, economic factors, etc. Pathogens evolve over time as well, what effect if any could this have on human evolution?
Is gene transfer a form of eugenics? Is it advantageous to use gene transfer to eliminate some genetic disorders? Can this and other technology be used to influence the evolution of our species? Should there be guidelines for the use of genetic technology to control its application to human evolution? Who should create and enforce these guidelines?
You are exploring the Amazon rainforests before it was completely destroyed. Particularly, you focus on a family of plants that are known to produce chemicals with great medicinal benefit. You sequenced the genomes of several related species and identified the gene, vge (à very good enzymea) responsible for the production of a potential anticancer drug. On the right is the schematic of the genomic region where the vge genes resides. You found that different species have different number of the vge genes. For example, the genome of spécies A (Sp. A) carries three copies of vge genes (vge-A, vge-B, and vge-C). Although they all encode the VGE enzyme and have the same function, their DNA sequences are not entirely identical to each other. Based on this observation, you can conclude that vge-A and vge-B are O orthologous to each other O paralogous to each other O analogous to each other O monophyletic to each other O None of the above Sp. A Sp. B Sp. C Sp. D vge-A vge-B vge-A vge-A vge-B…
Why is mutation important to evolution if it is the microevolutionary force t
The mutations which are of greatest importance to the process of evolution are those which are classified as: O spontaneous, germinal, gene mutations induced, germinal, gene mutations induced, somatic, chromosomal mutations O induced, somatic, gene mutations spontaneous, somatic, gene mutations
DNA _______. a. guides form b. is the basis of traits c. is transmitted from and function parents to offspring d. all of the above