Q: The main tools the U.S. government provides that can help plan a healthy diet are __________. DRIs,…
A: A healthy diet includes a variety of nutrient-dense foods from all food groups, including fruits,…
Q: Bacteria can be used to produce human growth hormone (HGH-a peptide/protein) through genetic…
A: Human growth hormone is basically a peptide hormone.It is produced by anterior pituitary.It mainly…
Q: NH₂ 1 N= CH: A B C C-N 3-4 HC HICI I OH B HICIO с OH E HICIH -21 High-energy bonds 044 P-O G O-P-O-…
A: ATP stands for Adenosine triphosphate.It is the energy currency of the cell.It is considered as…
Q: I was told the correct answer is 0.006. Please advise why this one is diffrent
A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: What is the arthropod's role in disease transmission such as malaria? Question 7 options: a)…
A: Arthropods, especially ticks and mosquitoes, are responsible for a number of parasitic and viral…
Q: Penicillium chrysogenum Morphology Picture attached. Description : 1. Conidium 2. Sterigmata 3.…
A: Penicillium notatum is a type of fungi.It comes under phylum ascomycetes.It can reproduce by all…
Q: 2. Fill in the labels on the following diagram that shows the light reactions of photosynthesis.
A: There are a few important points : We know that photosynthesis will take place in the green parts…
Q: Any break in the chain of infection prevents the spread of disease. Question 4 options: a)…
A: True.
Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…
A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…
Q: In the classic 1994 paper, "Does More Intensive Treatment of Acute Myocardial Infarction in the…
A: The passage is talking about the elderly patients who suffer from acute Myocardial Infarction which…
Q: Science Toolkit The Guilty Dentist hile biologists use the study of evolutionary relationships…
A: HIV stands for human immuno deficiency virus which is a retro virus responsible for causing AIDS. It…
Q: The gastrovascular cavity of cnidarians has two openings, one serves as mouth and the other serves…
A: Cnidaria is a phylum which is under kingdom Animalia that contains over 11,000 species of aquatic…
Q: Consider the cladogram shown. 1. Which pair of species shares the greatest number of derived…
A: Systematics tells about the relationship between taxons. Phylogenetic tree is given in the question.…
Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…
A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…
Q: draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the…
A: p21 protein: The p21 protein is a key protein that regulates the DNA repair process inside the…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: This is for an immunology class 1. Name of a type of host defense mechanism 2. One of the types…
A: Introduction: Immune system: an intricate system of organs, tissues, and the substances they produce…
Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…
A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…
Q: What is a protozoan cyst? Discuss the importance of this structure in the ability of Giardia to…
A: Introduction:- Protozoa are one celled animals found worldwide in most habitats. They are…
Q: In a certain type of pea plant, the gene for yellow color (Y) is dominant to the gene for green…
A: Answer: Heterozygous : When the both alleles present are of different types (dominant allele and…
Q: _______ is the net movement of substances from a high concentration to a low concentration medium,…
A: Introduction: Diffusion is the overall net movement of anything from a higher concentration to a…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: 4. In humans, brown eye color (B) is dominant to blue eye color (b). A woman who is homozygous…
A: An allele is one of two or more variations of a certain gene. A dominant allele can only show itself…
Q: 3. Why is rubisco considered to be the most important enzyme on earth? What does it do?
A: Introduction:- Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known as rubisco is an…
Q: Which of the following groupings of the abdominopelvic regions is medial? a. Hypochondriac,…
A: The ability to correctly interpret an X-ray film is crucial for medical professionals in order to…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: Explain this statement "In a sense, the life cycle in the organism".
A: Understanding the life cycle of an organism can help us understand its behavior, ecology, and…
Q: Write the 3 short term effects and 3 long term effects in given classification of substance
A: Drugs are the substances which have physical or physiological effects on the body.Drugs are used to…
Q: Name the commonly used vector for cloning genes into higher organisms.
A: A vector is essentially a DNA molecule (typically like plasmids or viruses) utilised in molecular…
Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…
A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…
Q: Identify a hormone from the anterior pituitary that is involved in ovum release and briefly describe…
A: The anterior pituitary, also known as the adenohypophysis, is a gland located at the base of the…
Q: explain how the skeletal, articular, and muscular systems work together to form the human skeletal…
A: Skeleton, articulates and muscles collectively forms musculoskeletal system also called as locomotor…
Q: When we measure species density. If you apply random sampling and systematic sampling to a site…
A: When we measure species density, we always choose the random sampling method as sampling method.…
Q: Flatworms show bilateral symmetry and some cephalization. True False Some parasitic…
A: Carl Linneaus form animal kingdom along with other 4 kingdom. Under animal kingdom, animals are…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: Considering the pandemic brought about by COVID-19, there has been plant-based products/ herbal…
A: Nowadays we are very familiar with the deadly virus Covid-19.It form pandemic in 2019-2021.This…
Q: You're trying to figure out the genotype of the mother based on the phenotypes of the offspring. Why…
A: Genetic constitution is referred to genotype and the appearance is referred to as phenotype.…
Q: presented in this MMWR article, explain the trends that were seen with giardia infection across the…
A: The trends seen with Giardia infection across the nation from 2011-2012 showed an overall decrease.…
Q: 2. If a cell has a large surface area:volume ratio will the movement of molecules in and out of the…
A: Cells are the units of life. Each cell has a definite shape and size. The newly formed cells are…
Q: A rectocele is a/an __________ of the rectum.
A: A rectocele is a/an ___prolapsed pelvic organ _______ of the rectum. So rectocele is a prolapsed…
Q: Per the book the answer to this questions is probability is 0.006.
A: The cross is between parents having genotype AaBb x Aabb. This genotype will produce four and two…
Q: With an example, explain how a change in an amino acid can change the structure of a protein.
A: The amino acid sequence of the protein is responsible for generating its 3D structure. A mutation in…
Q: What are the immunosensors used in the medical field? What are some examples of immunosensors? What…
A: Immunosensor are actually biosensor which is established on the theory of immune system where an…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: The research contributes to a better knowledge of illnesses and other health issues, such as their…
Q: during the absolute refractory period k+ channels are open while na+ channels are 1. activated…
A: The phrase "refractory phase" refers to the period of time when a specific cell or organ is unable…
Q: 2. The Theory of Endosymbiosis states that: Plant cells are endosymbionts a. b. C. d. The…
A: Endosymbiosis is the theory of evolution of eukaryotes. Eukaryotes have a well partitioned cellular…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: What is true about the geographic context of trees and keys? a. Neither phylogenetic trees nor…
A: Geographical context means that some organisms may not be distributed worldwide that is they may be…
Ee.35.
How do you make a 10x solution of 1M dextrose? What should be the volume and how many grams. (show your work)
Step by step
Solved in 2 steps
- 1. Given .750L of a 12M HCI solution, what volume of 5.00M HCI could you make?17. If an intravenous injection contains 20% (w/v) of mannitol, how many milliliters of the injection should be administered to provide a patient with 100 g of mannitol? 17. 500 mL9. 3 μL of a 45 mM stock solution of a substrate is added to 8 mL of water. Calculate the following values. The substrate molecular weight is 125 g/mol. Substrate volume in mL Dilution factor Substrate number of moles Substrate concentration for the diluted solution in mM Substrate concentration for the diluted solution in mole/L Substrate concentration for the diluted solution in mg/mL
- 29. A topical solution contains 3% w/v hydro- quinone. How many liters of the solution can be prepared from 30 g of hydroqui- none? 29. 1 liter3 mL of a 45 mM stock solution of a substrate is added to 8 mL of water. Calculate the following values. The substrate molecular weight is 125 g/mol. Calculate the following values: Substrate Volume in mL Dilution Factor Substrate number of moles Substrate concentration for the diluted solution in mM Substrate concentration for the diluted solution in mole/L Substrate concentration for the diluted solution in mg/mLhow many grams of sr(no2)2 are needed to make 200 ml of 0.300M solution of sr(no2)2
- . A prescriber ordered 240 mL of ¾ strength Sustacal PO B.I.D. Explain how you would use water as a diluent to mix this solution. Show your work with units and describe how much water and how much Sustacal you would use to create this mixture..Penicillin G potassium 5000 units Isotonic Sodium Chloride Solution ad 15 mL Sig. Nose drop Using soluble penicillin tablets, each containing 100,000 units of crystalline penicillin G potassium, explain how you would obtain penicillin G potassium needed in compounding the prescription.I. How much of a 3X stock of SDS Loading Buffer should you add to 20 uL of sample to make 30 uL of 1X?
- 67. Purified water contains not more than 10 ppm of total solids. Express this concen- tration as a percentage. 67. 0.001% w/v5 L of 0.2 M dextrose solution from 5 M dextrose solution3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your answers using two decimal places. Follow this format in typing your answers: answerabbreviated unit (e.g. 3.00 g, 0.75 ml, 10.25 mg): Components Amount per liter Polypeptone 3.0 g NazHPO4 5.64 g (Available as NazHPO4 · 7H2O*) Monopotassium phosphate 0.225 g Sodium chloride 0.5% KCN 0.075 g (Available as 10,000 ppm solution) *MW (g/mol): Na-23; P-31; H-1; O-16 3.4. Sodium chloride (