HIV1/2 refers to A. HIV antigen 1 and 2 B. HIV antibody 1 and 2

Q: 3) Whole-mount in situ hybridization can be used to test for the function of non-coding DNA region.…

A: * Whole mount in situ hybridization is a tool that aids for temporal and spatial dissection of gene…

Q: What are the natural plants that the body can consume that speed up the burning process

A: The procedure through which our body transforms what we eat or drink into energy is known as…

Q: Once in human cells, which of the following statements might best describe how COVID19 replicates?…

A: Coronaviruses make full-length copies of their genomic RNA, which are integrated into freshly formed…

Q: Both statements are false. I. In Arabidopsis thaliana, cytosine demethylation within the Superman…

A: SUPERMAN gene involved in the formation of boundary between stamen and carpel in flower.  If…

Q: After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…

A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…

Q: In photosystem II proton coupled electron transfer reactions are thought to be necessary after which…

A: *The enzyme photosystem II catalyzes light driven oxidation of water in oxygenic photosynthesis.…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: ing? The Carbon Cycle 1 5 1-water vapor; 4 - runoff 1-atmospheric nitrogen; 4 - nitrifying bacteria…

A: The carbon cycle depicts the continuous movement of carbon atoms from the environment to the Land…

Q: How does KU proteins promote DNA repair during mitosis? Explain.

A: DNA repair  It involves different processes through which a cell determines and rectifies the damage…

Q: How might one test whether the differences in moth density in the two types of plants are due to…

A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…

Q: It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5…

A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…

Q: Which of the following replication enzymes will most likely be involved in COVID19 RNA replication?…

A: Coronaviruses (CoVs) are the most common type of virus in the Nidovirales order, which comprises the…

Q: 18. cell differentiation is where a cell makes an irreversible commitment to follow a specific…

A: Introduction :- The process by which dividing cells change their functional or phenotypic type is…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: Determine the ventricular electrical axis in the following recording: Explain your answer

A: The ECG's axis is one of the major direction in which the overall electrical activity of the heart…

Q: Match the organisms with the appropriate description. ___ lancelets          a. pouched mammals ___…

A:

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: Which of the following diseases does not generally follow Mendelian rules of inheritance? breast…

A: Breast Cancer

Q: How will you solve the problematic taxon based on systematic and phylogeny?

A: Answer-- A taxon is defined as a single species that may represent two or more sibling species that…

Q: Presence of proximal and distal promoters in Drosophila melanogaster for alcohol dehydrogenase. Is…

A: Drosophila melanogaster is a species of fly in the family Drosophilidae. The species is often…

Q: Identify the most recent varieties of strawberry. Write a report on the identifying characteristic…

A: Strawberry is a widely grown around the world as a fruit and is used in various preparations such as…

Q: Describe the anatomical and physiological adaptations that aroseduring the transition to life on…

A: Life evolved underwater so the earth was totally covered with water at the beginning of humankind,…

Q: Describe the functions of the following proteins during DNA replication: (i) Polymerase delta (ii)…

A: Introduction DNA replication:- It is the process by which the genome's DNA is copied in cells, It…

Q: Question 23 Where is the ATP primarily made in a plant cell? O stroma and mitochondrial…

A: Introduction A plant cell is a eukaryotic cell that contain a distinct nucleus and certain…

Q: .People with Type O blood lack antigens on the blood cells, if a patient with Type B blood receives…

A: INTRODUCTION Organs, white blood cells, proteins, and chemicals make up the immune system, which is…

Q: How do viroids and prions differ from viruses?

A: A virus is a small infectious agent which replicates only within an organism's live cells. Viruses…

Q: Instructions: Answer the following problem using the punett square and identify its Genotypic ratio…

A: Allele is the alternative pairs of genes that occupy a specific location on homologous chromosome…

Q: Question 12 A student performing a biological specimen studies using cancer cells, wants to check…

A: methyl orange is used as indicator, this value is also known as the m-value. The method is suitable…

Q: the cytoplasmic membrane is universally similar across the three Domains of life. Discuss this…

A: The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane) is a biological…

Q: Question 62 Joshua Akey found evidence that historic mating and hybridization between Modern Humans…

A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes."…

Q: Natural Selection A Process of Evolution It wasn't until the year 1800 a man named Jean-Baptiste de…

A: Answer

Q: What is the importance of surfactant in the lungs?   it reduces the surface tension of water in the…

A: Introduction Pulmonary surfactant (PS) is a protein and lipid mixture produced by alveolar type-II…

Q: xpressed as X₁CO₂ + x₂H₂OX3O2 + X4C6H₁2O6

A: Photosynthesis is the process by which plants synthesise food(glucose) in the presence of sunlight.…

Q: The following DNA sequence is a bacterial promoter with numbered nucleotides. The 3' end is the…

A: Which nucleotide number is the 5' end of 35 site-     T   Which nucleotide number is the 3' end of…

Q: How do bacteria and archaea differ from each other? Contrast prokaryotic cells with eukaryotic…

A: Prokaryotes include Archaea and Bacteria, which are two different types of microbes. Archaea and…

Q: 9.Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…

A: Immunity deals with the study of how body's immune system works against foreign pathogens to…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: Cell determination is due to cytoplasmic effectors that cause the cell to irreversibly commit to…

A: Cytoplasmic determinants are special molecules which play a very important role during oocyte…

Q: ос О А Ов No answer text provided.

A: Several post-translational changes of nucleosomal histones' amino-terminal tails can impact…

Q: In ELISA, what is the importance of washing? When does washing is performed?

A: Introduction :- Enzyme-linked immunoassay (ELISA) is an acronym for enzyme-linked immunoassay.…

Q: Two different species of bacteria are growing together in a mixed biofilm in the intestine of a…

A: Autoinducer-2 (AI-2) is a signal molecule produced by LuxS, an enzyme found in many bacterial…

Q: Differential lengths of poly-A tails affect mRNA stability. Pre-transcriptional control…

A: According to bartleby guidelines only first question is to be answered. So upload other questions…

Q: ndustrial effluent from a metal processing factory released Cu into a nearby river without any…

A: Introduction The act of observing and measuring the state and continuing changes in ecosystems,…

Q: Consider the following statements and indicate whether each presents an idea of Jean- Baptiste…

A: According to our guideline we can answer only the first question. The second question is completely…

Q: methylation

A: The DNA methylation regulates the gene expression by recruiting  the proteins that are involved in…

Q: 1. Nutrigenomics is the study of how diet and gene expression interact throug molecular mechanisms.…

A: Epigenetic modifications are alterations in the genes without changing the exact or original DNA…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: Discuss the results of the data Topic: Tests for Hydrocarbons experiment

A: In this test of hydrocarbons there is ignition testing the determine hydrocarbon the first test is…

Q: How many different sequence possibilities are there for a double-stranded RNA polymer that is 6…

A: At each base, one can have any of the four different bases (A,U,C or G). Therefore for the first…

Q: 4.Why does the right ventricle need to pump the blood to the lungs via the left and right pulmonary…

A: Heart is muscular pumping structure which is used to supply oxygen rich blood to all parts of body.…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.