>chromosomal  ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA  >mutant2  ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGATGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA Briefly discuss why mutant 2 fails to produce functional protein.

Q: Sex determination of child is done by whose chromosome?

A: Chromosomes are the thread like structures which are located in the nucleus. There are 23 pairs of…

Q: to what do correspond respectively the grey, black and dotted lines? Indicate below the name of the…

A: Replication is the process by which the single mother strand helps to produce two daughter strands.…

Q: Progeny Pubescent Genotypes Parents Glabrous Pubescent x 76 79 Glabrous Pubescent x 58 Pubescent…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: explain the Nondisjunction during first meiotic division

A: The process in which the diploid cell produces haploid gametes is called meiosis. The chromosomes…

Q: What will happen to the person if she/he had more than or less than 46 chromosomes?

A: Each human cell ordinarily has 23 pairs of chromosomes, for a total of 46 chromosomes. A shift in…

Q: autosomal recessive autosomal dominant X-linked dominant X-linked recessive Y-linked

A: Answer: A pedigree is a fmily tree or chart made of symbols and lines that represent a person…

Q: CHILD #1 Genotype Phenotype | | | ||| From Edward From Jenna

A: Given: D = long eyelashes  d = short eyelashes B = Brown eyes        b = red eyes F = freckles…

Q: If a genetic male failed to produce MIS during fetal life, what would the result be?

A: The Müllerian-inhibiting substance (MIS) is a protein that is secreted from the testes, which leads…

Q: Telophase II Chromosome number per daughter cell Chromosome composition per daughter cell

A: Meiosis is referred to as the reductional division of a cell. Sach a name is given to this division…

Q: What would be the sex of a human with each of the following numbersof sex chromosomes?A. XXXB. X…

A: Sex chromosomes regulate the gender of the organism.

Q: What are chromosomal disorders? Also gives a suitable example.

A: The chromosomes are thread-like structure located in the nuclei of both plant and animal cells. They…

Q: Identify the stage of meiosis for the following cells:

A: Since we only answer one question at a time, we’ll answer the first one. Please resubmit the…

Q: male having genotype AaBbCC mates with a female having genotype aaBBcc.

A: The fork line method can be used by figuring the occurrence of each gene or set of genes to be found…

Q: Cross a female (XX) with a male (XY). Provide the genotypic and phenotypic ratio of the cross

A: Cross of a female (XX) and Male (XY) Female/Male X Y X XX (Female) XY (Male) X XX (Female) XY…

Q: The gene that determines whether a child becomes a Male or a female is located on a specific pair of…

A: There are two types of chromosomes found in our body, autosomes and allosomes.  Autosomes are found…

Q: In which parent and during which meiotic division did non-disjunction occur? If there is more than…

A:

Q: 38

A: The indirect process of cell division in which the chromosomes of brain cells divide once but…

Q: Crossing over gives genetic and happens during the stage of meiosis I.

A: Cell division happens when a parent cell divides into two or more daughter cells.  There are two…

Q: person with XXY sex chromosomes will typically:

A: xxy is the klinefelter syndrome .

Q: Define sex chromosomes

A: The DNA (Deoxyribonucleic acid) that possess all the information about the genetic material of the…

Q: Crossing over occurs during prophase Il of Meiosis.

A: Crossing over is essential for the normal segregation of chromosomes during meiosis. It is also…

Q: Crossing over occurs during the __________________________ phase of meiosis.

A: A cell cycle is a series of event that occurs in a cell to divide it into two cells by the process…

Q: en the maternal red

A: D)  Follicle stimulating hormone

Q: what is Rare mitotic nondisjunction

A: Mitosis - Mitosis is a process in which one cell divides to form two new daughter cells. These two…

Q: 2n=46 2. 3. MeioticStage: MeioticStage: Diploid no: Haploid no: Diploid no: Haploid no:

A: Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half…

Q: Which phase of meiosis explains Mendel's Law of Segregation? Anaphase I Anaphase I| O Metaphase II O…

A: Answer. Meiosis is a type of cell division that occurs in germ cells that reduces the number of…

Q: Number of FEMALE offspring that would have the condition of an X-linked trait, if an affected man…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: tHomologous Chromoso C. Area on a chromosome where a gene is found: genes d. Shows two different…

A: Gametes are reproductive cells that are produced through the meiotic division process. In this…

Q: To define the adavantage and disadvantage of a compact chromosomal structure.

A: Chromatin A mixture of protein and DNA together makes up the chromatin. This chromatin is a…

Q: What are chromosomal Defects. List and Explain any 5 of them.

A: Almost every cell in our body contains 23 pairs of chromosomes, for a total of 46 chromosomes. Half…

Q: Oogenesis results in 1 gamete per meiotic division. TRUE OR FALSE

A: Oogenesis is the process of formation of female gamete. This process begins inside the fetus before…

Q: What would be the sex of a human with each of the following setsof sex chromosomes?A. XXX C. XYYB. X…

A: BASIC INFORMATION Humans have 23 pairs of chromosomes out of which 44 are autosomes and 2 are sex…

Q: Discuss the significance of the mitotic process and meiotic process.

A: Mitotic process or mitosis is a type of cell division process which takes place in the somatic cells…

Q: From the cross EEFFGGDd * EEffGgDd, what is the probability will be EEEfGgDd

A: Genotype is the genetic makeup of an organism.

Q: Draw a line down the middle of the page. On the LEFT side of the line, draw and label the following…

A: Meiosis is one of the types of cell divisions. This reduces the ploidy level of the parent cell to…

Q: meiotic stage. Each a

A:

Q: Indicate below the name of the chromosomal regions that are squared and named respectively A and B…

A: John Cairns was the first person to observe the replicating chromosome in E.Coli by autoradiography…

Q: Draw and label the first polar body and ootid cells for an organism that has a diploid chromosome…

A: In meiosis 1, a diploid cell becomes 2 haploid (23 chromosomes) daughter cells, each chromosome has…

Q: The genotype AABBCcDD will have the following gametes

A:

Q: Inspect Figure 3-8: which meiotic stage is responsiblefor generating Mendel’s second law?

A: Numerous cells constitute the body of an organism. Cells forms tissues and organs. There are a total…

Q: Define genotype class

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: Define X chromosome

A: Chromosomes are observed in the cell's nucleus and contain the genetic material of the cell. In…

Q: Which of the males is the father?  -male1  -male2  - cannot tell from this gel

A: Child should receive DNA from either mother or the father. Some from the mother some from the…

Q: Using the Dihybrid Cross, Give the Total Number and Types of Gametes formed.    1. AaBbCCDd  2.…

A: Genotype is considered a genetic combination of traits in an organism. Mandel's law of inheritance…

Q: Blue eyes Brown eyes Heterozygous Homozygous BB Bb bb O O O

A: Human cells carry two copies of each chromosomes and they have two versions of each gene. An allele…