Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and acyl-CoA DH bound-FAD, respectively, calculate the free energy for a pair of electrons originating from the first reaction of b-oxidation of a fatty acyl group, as it traverses the ETC. R= 8.315 x 103 J/mol K; Faraday constant, F= 96.48 KJ/V-mol, assume standard state T= 25°C and physiological conditions are T= 37°C. Report a whole number. Remember a Reduction potential is DEFINED as X(x) +---> X(red) Be sure you have defined your oxidation and reduction species properly. kJ/mole
Q: Which of the following is not true about the properties of a peptide (amide) bond? a.The bond…
A: A peptide is a polymer of amino acid residues linked together via a peptide bond. The peptide bond…
Q: vo (μM/min) 25 20 15 10 5 0 7 VO (μM/min) VS pH 8 pH 9.5 10.4
A: Enzymes are the catalysts that function to increase the rate of reaction by decreasing their…
Q: Imidazole is used to elute His6-tagged proteins from Ni-NTA resins because imidazole is: a.…
A: On the Ni-NTA column the protein that is His-tagged bind to the column with high affinity. The…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…
A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…
Q: Calculate ΔGinward. Is energy required for transport to happen? The internal pH of a lysosome= 4.0…
A: The amount of change in free energy i.e. change in Gibbs free energy for the transport of an ion…
Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…
A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…
Q: a. Provide names for both metabolites. b. What kind of reaction occurs here? c. What enzyme…
A: Biochemical reactions are catalyzed by enzymes in which bio-metabolites are transformed into another…
Q: Question 7 In the human body, under oxygen rich and oxygen poor conditions, respectively, pyruvate…
A: Respiration at molecular level refers to the process through which cells catabolize biomolecules…
Q: 1. List the 3 final products of glycolysis.
A: Glycolysis breaks down glucose into two molecules of pyruvate that occurs in the cytoplasm and ATP…
Q: What are the key differences between DNA synthesis (in the context of DNA replication) and RNA…
A: DNA is the genetic material. Replication is the process that copies the DNA to produce identical…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific points. Trypsin…
Q: DNA: Whats the structural and functional differences between heterochromatin and euchromatin?
A: DNA, the genetic material is organized as chromosomes inside the cell nucleus. The chromosomes have…
Q: Concerning the citric acid cycle (TCA cycle), which of the following statements is false? The TCA…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Which of the following is true under the following conditions: an enzyme displaying Michaelis-Menten…
A: Enzymes are protein molecules that increase the rate of reaction by million times. Enzymes do not…
Q: What biomolecules have alcohol functional group in them? Give an example of a specific biomolecule…
A: Biomolecules possess different functional groups such as alcohol group, amino group, carboxyl group,…
Q: What is the free energy for transport of glucose from outside the cell to inside the cell 37°C when…
A: When an ion/molecule/solute moves up or down a concentration gradient, there is a change in free…
Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…
A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…
Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Pyruvate can be converted to glucose via gluconeogenesis, or it can be oxidized to acetyl-CoA for…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: if you have a dialysis tube filled with 10 mL of 20% sucrose solution in a beaker with 100 mL of…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: of the gluconeogenesis wing is not true? A. Phosphofructokinase-1 (PFK-1) and…
A: Glycolysis - is a process in which one mole of glucose is partially oxidized into two moles of…
Q: 27. While culturing some cells, you lower the temperature of the culture. What happens immediately…
A: Cell membrane are composed of lipid bilayer and proteins. Membrane fluidity depends on the content…
Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…
A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…
Q: Conversion of oleic acid to its more stable trans-isomer can be triggered by light. Do you think…
A: Oleic Acid (OA): An omega-9 fatty acid is an oleic acid. The body can produce it. Foods contain it…
Q: When a protein is folded in aqueous solution, some residues are driven inside to form a “hydrophobic…
A: Introduction Proteins are the most abundant macromolecule present in our body. Proteins performs…
Q: In the peptide, SWEETLY, bond via its side chain. (Give the full name of the amino acids) can still…
A: Recall that: for a given peptide amino acid sequences are written with N-terminal amino acid on the…
Q: DNA: Explain nick translation and strand displacement
A:
Q: 29. What is the action of the Na/K pump? A. It is bidirectional for both ions B. It actively…
A: Introduction Plasma membrane or cell membrane is a outermost membrane in animal cell. It protect the…
Q: Will disaccharides and polysaccharides give positive results in Molisch test? How?
A: Molisch’s test is a specific test for the identification of carbohydrates in a sample. The test uses…
Q: A biosynthetic pathway for the synthesis of two molecules, E or H, from molecule A is shown below.…
A: Enzymes can e reversibly inhibited in presence of competitive and non-competitive inhibitors. Such…
Q: Define the planted motif search problem.
A: INTRODUCTION : A sequence motif - This sequence motif is a nucleotide or amino acid sequence pattern…
Q: The following are importance of carbohydrates EXCEPT: O carbohydrates are non-polar molecules O…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Depending on their size, they can be…
Q: (a) Draw the complete linear structure of a small peptide sequence GAKD. (b) At pH=7.0, how many net…
A: Peptides are composed of twenty standard amino acids. The twenty standard amino acids differ from…
Q: What does bleach do to hair
A: Melanin, the pigment that also affects the colour of your skin, also determines the colour of your…
Q: 10. Which of the following statements regarding insulin is false? A. Insulin is a signal that…
A: When blood glucose concentration increases or decreases, carbohydrate metabolism is coordinated by…
Q: Which of the following statement about the enzyme thermodynamics is TRUE? a. Enzymes increase…
A: Introduction Enzymes are known as bio-catalyst. All the metabolic reaction of our body is enzyme…
Q: quantitative testing methods. Discuss two of them. (macromolecules lab questions) ( tests for…
A: Qualitative tests tell us whether or not the biomolecule of interest is present in a sample.…
Q: Why do you think the TCA critical pathway in Metabolism is needed
A: Introduction There are various metabolic process occur in our body. all metabolic processes are…
Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…
A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…
Q: 2. You made a pH=2.5 buffer solution by mixing NaOH and glycine to give a solution that is 0.20 M in…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Which pathways use substrate-level phosphorylation and which use oxidative phosphorylation?
A: Substrate-level phosphorylation is a metabolic process that involves the direct transfer of a…
Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…
A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…
Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: what is the concetration of a lysozyme solution with an absorbance of 0.720 measured at 280 nm(…
A: Measuring the concentration of a substance in solution on the basis of its absorbance forms the…
Q: For the questions below be sure to show your work as well as the answer to the question. In this…
A: Hi! Thank you for the question. We are authorized to answer five subparts at a time, since you have…
Q: You measure Protein A and Protein B to have a Kd of 10-8 M. At what concentration of Protein B will…
A: Here we have 2 proteins, 'A' and 'B' . The reversible equilibrium between these 2 proteins is shown…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Energetics of the Hexokinase Reaction The standard-state free energy change. Gfor the hexokinase reaction, is — 1 6.7 kJ/mol. Use the values in Table I to calculate the value of Gfor this reaction in the erythrocyte at 37°C.Given that the reduction potential Eo'=-320, +10, +816, and +50mV for NAD+, fumarate, 02 and G3P DH bound FAD, respectively, calculate the free energy for a pair of electrons originating from the oxidation of glycerol-3-P to DHAP of, as it traverses the ETC. R = 8.315 x 10 J/mol K; Faraday constant, F= 96.48 KJ/V-mol, assume standard state T= 25°C and physiological conditions are T= 37°C. Report a whole number. Remember a Reduction potential is DEFINED as X(ax) +e- --> X(red) Be sure you have defined your oxidation and reduction species properly. kJ/moleThe standard reduction potential for ubiquione (A or coenzyme Q) is .045 V, and the standard reduciton potential (E) for FAD is -0.219 V. Using these values, show that the oxidation for FADH2 by ubiquinone theoretically liberates enough energy to drive the synthesis of ATP. Faraday constant =96.48KJ/Vol delta G' standard for ATP Synthesis is +30.5 KJ/mol R=8.314 J/mol K=1.987 cal/mol K
- Acetyl CoA + 2H* + 2e = pyruvate + COASH E = -0.48 V Ubiquinone + 2H* + 2e = Ubiquinol E" = +0.04 V Consider the redox rxn wherein a pair of e passes from pyruvate to ubiquinone. Calculate the change in standard Gibbs free energy (kJ/mol). Report answer to two decimal places.Acetyl-CoA is formed from acetate by coupling two reactions: ATP + H20 = ADP + P; AG" = -36.03 kJ/mol %3D acetate + CoA acetyl CoA + H20 AG" = +33.21 kJ/mol %3D 1. Calculate the overall AG' (reported up to two decimal places) for the net reaction. kJ/mol 2. Calculate the Keg (reported up to two decimal places and do not use scientific notation) for the net reaction at 298.15K. NOTE: R= 8.314 x 103 kJ/mol-KCalculate AG for this reaction under the following conditions: 37°C, pH 7, [Pyruvate] = [CO₂] = 4.0 mM, [OAA] = 2.0 mM, [ATP] = 3.5 mM, [P;] = 5.0 mM, and [ADP] = 1.8 mM. Use 2 signficant figures. AG= i kJ.mol-1 Under these conditions, the reaction is (Tolerance is +/- 2%)
- Consider the two half-reactions below and their standard reduction potentials. NAD+ + H+ + 2e → NADH Elo= -0.32 V a-Ketoglutarate + CO₂ + 2H+ + 2e → Isocitrate E' = -0.38 V (a) What is AE" for the spontaneous redox reaction that is, the reaction that actually occurs under standard biochemical conditions (pH 7)? (b) Which of the following statements are correct under standard biochemical conditions? i. The concentration of H+ is 1.0 M. ii. The reaction NAD+ + Isocitrate → NADH + H+ + a-Ketoglutarate + CO₂ is favor- able. iii. NAD+ accepts electrons from isocitrate. iv. The NAD → NADH reaction actually occurs in reverse. The a-ketoglutarate → isocitrate reaction occurs as written. (c) Calculate AG" for the reaction in (a). (pH 7, 25°C, pressure, 1 atm.) (d) Suppose that the actual conditions are T = 25°C, pH = 7, CO₂ = 1 atm, [a-Ketoglutarate] 10 mM, [NAD+] = 2.5 mM, and [NADH] = 0.5 mM. PAR = 2 mM, [Isocitrate] DE What is the value of AG under those conditions? (Hints: pH 7 is already…Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq of the reaction Pyruvate + NADH Lactate + NADH+H+. Note the temperature of this reaction will not affect the standard reducton potentialFor lactate dehydrogenase reaction if km for NADH is 2×10^-4 M . What concentration of it would be appropriate for determining Km for pyruvate?
- Calculate the standard free energy change (AG) for the transfer of electrons from succinate to ubiquinone: Succinate + ubiquinone O-2.7 kJ/mol O2.7 kJ/mol O-8.7 kJ/mol O 14.7 kJ/mol succinate dehydrogenase relevant half-reactions and standard reduction potentials: fumarate + 2 H* + 2 e succinate ubiquinone + 2H + 2 e -6.0 kJ/mol 11 Fumarate + ubiquinol ubiquinol E = 0.031 V E = 0.045 VIf a 0.1 M solution of glucose 1- phosphate at 25 °C is incubated with a catalytic amount of phosphoglucomutase, the glucose 1-phosphate is transformed to glucose 6-phosphate. At equilibrium, the concentrations of the reaction components are Calculate Keq and ΔG′° for this reaction.explain in quantitative terms the circumstances under which the following reaction can porceed; L-malate + NAD+ (forward arrow) oxaloacetate + NADH + H+ delta G' standard = +29.7 KJ/mol