For each of the following, identify whether it is an example of primary, secondary, or t structure that might be observed in a nucleic acid (such as DNA). Answers may be us than once. stem-loop nucleotide sequence B form supercoiling kinetochore of a yeast chromosome nucleosome TAHYA [Choose ] ✓secondary structure primary structure tertiary structure tertion <> <>
Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…
A: The production or synthesis of new DNA from old DNA strands is known as DNA replication. It occurs…
Q: In a particular plant species, a cross between pure breeding strains both of which have white…
A: Non- Mendelian inheritance is a type of inheritance in which traits or characters do not separate…
Q: Question 2. Using different colors to distinguish chromosomes of maternal and paternal origin, draw…
A: Meiosis is a type of cell division that occurs during gamete formation. It is a kind of division…
Q: Epulopiscium fishelsoni is a Gram-positive bacteria found in the gut of a sturgeon fish. The largest…
A: Microscope is used to magnify an object. In biology laboratories, light microscopes are used more…
Q: Cdc45 Cdc6 Cdt1 Clamp Clamp loader CMG complex Ctf4 DDK Dna Pol a DNA Pol 8 DNA Poly DNA helicase…
A: The map shows the replication of DNA related to Cdc45.
Q: The graphs show the quantities of selected vitamins and mineral ions in four foods. Which food is…
A: Blood transfer is one of its main purposes. Blood veins resemble a system of roadways where packages…
Q: Cystic fibrosis What causes this disorder? The genes/chromosomes that are involved Is the disorder…
A: Cystic fibrosis (CF) is a genetic disease that affects protein in the body. Cystic fibrosis patients…
Q: In one square of a hemacytometer you count 55 cells. What is the approximate concentration of cells…
A: Hemocytometer is a device that is used to calculate the number of blood cells in a given sample. It…
Q: Mark the corresponding elements in the picture of the myocardium: 1. Unchanged 2. 3. located near…
A: Tiger hearts: The largest members of the cat family live in a variety of settings throughout…
Q: sketch stages of mitosis including all s phases
A: The orderly sequence of events by which a cell duplicate its DNA, synthesizes its other components…
Q: Benedict's solution tests for the presence of molecules made when amino acids have been joined…
A: The given statement is false. So, the correct answer is option B. False.Benedict's solution does not…
Q: Place a single word into each sentence, and then arrange the sentences into a logical paragraph…
A: Neurons are a component of the nervous system and they are responsible for the generation and…
Q: Lead inhibits enzymes and can interfere with development of the nervous system. One battery…
A: Lead has been shown to inhibit enzymes and can harm the development of the nervous system. Because…
Q: Animal Group Cnidaria Platyhelminthes Typical Environment Typical Lifestyle of Adult Form…
A: Taxonomy is defined as the science of naming, describing and classifying diverse living organisms…
Q: Monozygotic twins 100% of genes Twin studies Dizygotic twins 50% of genes on average Special…
A: Adoption and dizygotic twins are important in the genetics research for their roles as they play…
Q: Give typed full explanation Diagram the path of electron flow from NADH to the final electron…
A: respiratory process is to release and utilise the energy stored in NADH+H' and FADH, This is…
Q: How can understanding how our bodies have evolved differently for sports help create personalized…
A: Understanding how our bodies have evolved differently for sports can significantly benefit the…
Q: In a tumor sample with a mutated fumarate dehydrogenase that is less active than the normal isoform,…
A: The correct answer is Decreased expression of hypoxia-inducible factor alpha.The gene fumarate…
Q: 1) What is the purpose in first conducting the inoculation assay prior to treating our SY5Y cells…
A: Disclaimer: "Bartleby guidelines allow the first question to be solved. And please ask other…
Q: 7. when there is sufficient oxygen , blank ATP molecules can be made by cellular respiration,…
A: Cellular respiration is a metabolic pathway that uses glucose to produce ATP, an organic compound…
Q: Move the descriptions and images into the correct boxes to assess your understanding of simple,…
A: "Within the domain of microbiology, staining procedures play a significant part in revealing the…
Q: Chemotherapeutic agents can promote apoptosis in cancer cells by these mechanisms except; Group of…
A: Chemotherapy is a basic component of cancer treatment, aimed at eliminating cancerous cells by…
Q: Why does counting 5 Boxes in each chamber of the hemacytometer gives you the number of cells in a ul…
A: Hemacytometer is a medical instrument used to measure the concentration of blood components in a…
Q: B b B heterozygous. BB Bb In the image above, b Bb bb % are homozygous dominant. % are homozygygous…
A: Homozygous: An individual is said to be homozygous for a trait if they have two identical alleles…
Q: The axial skeleton contains 1. skull 2. scapula 3. true and false ribs 4. vertebrae 5. phalanges O…
A: The axial skeleton contains ---1. Skull, 3. true and false ribs, 4. Vertebrae.
Q: How and why do cells express different genes to produce different enzymes and proteins? Explains…
A: Each cell in the body have particular genes to generate particular enzymes and proteins, which…
Q: A couple finds out that both the male and the female are heterozygotes (carriers) for Tay Sachs.…
A: A rare genetic illness called Tay-Sachs is inherited from one parent to the next. It results from…
Q: 3. Create a timeline showing the evolution of different types of plants AND the different…
A: 1. Algae (1 billion years ago) - Main Characteristics: Aquatic, lacks true roots, stems, or…
Q: A grain of sand is about 10-3m in diameter. A human hair is about 0.1mm in diameter. A red blood…
A: Various units of measurement are employed to quantify biological entities. These include millimeters…
Q: Based upon the changes in permeability seen in the trace below and your knowledge of ion…
A: This is the graph which shows how a stimulus can arouse an action potential from a resting membrane…
Q: In Caenorhabditis elegans, the level of expression of genes on both X chromosomes of females is…
A: The process by which the information encoded in a gene is converted into a function is known as gene…
Q: 3. In a population with two alleles for a particular locus, B and b, the allele frequency of B is…
A: The Hardy-Weinberg equilibrium is a fundamental genetic principle stating that, in the absence of…
Q: Menisci are sacs filled with lubricating fluid and lined with synovial membranes. They are found…
A: Joint is a structure which helps in connecting two bones with each other.Joints are classified as…
Q: 2.Draw a neat, clean and labelled diagram of Chloroplast.
A: An organelle found in the cells of plants and specific algae called a chloroplast is where…
Q: You will start off by laying out your individual nucleotides for the first strand using the…
A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…
Q: essay of Methane extraction from anaerobic digestion.
A: Methane, renowned as a potent greenhouse gas, simultaneously presents an invaluable renewable energy…
Q: Chromosome terms Study the image below, then click on all of the true statements. These homologous…
A: Homologous chromosomes are chromosomes that have the same genes in the same loci and are inherited…
Q: 1. Draw and label a cell with the following organelles: nucleus, rough ER, Golgi apparatus,…
A: Cell is basically an elemental unit of body and a part of structural organisation in which various…
Q: 10. What is light compensation point and draw a complete graph that is showing relationship between…
A: Metabolism is a phenomenon takes place inside the living organism in which new substances are…
Q: Part A If A + G/T + C equals 0.5 in one strand, what is the ratio of these bases in the…
A: DNA is made up of two DNA stands wound around each other. Each strand consists of nucleotides which…
Q: Given a retic count of 6.5%. Calculate the corrected retic count and RPI. The RBC count is 2.90 x…
A: To determine the corrected reticulocyte count and calculate the RPI (Reticulocyte Production Index),…
Q: Assume a forest with 2 species of animals (A and B) and are competing for the same resources.…
A: In a competitive ecosystem where two species, A and B, vie for the same limited resources, the…
Q: QUESTION 14 H H >< H H FO OH Which of the following best describes the structure above? A. It is a…
A: Biomolecules are also known as biological molecules. They are produced by the cells of living…
Q: Based on a 2000 kcal diet per day, match the AMDRS (ranges of intake) with the numbers below for…
A: Biological macromolecules are the molecules that are required in sufficient amounts by the body.The…
Q: The dominant white allele (W) is a homozygous lethal and is dominant over the full-color allele (w)…
A: In this genetic scenario involving horse coat color, we have two genes at play: one for white color…
Q: When labeling the loci on the map, the two outside loci must be in alphabetical order. For example,…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Should we devote more resources to treating cancer or to preventing it? Explain.
A: Cancer is a medical condition caused by unstoppable cell divisions resulting formation of a cell…
Q: Falling energy levels increase the cellular AMP/ATP ratio, priming AMPK for activation by the liver…
A: In order to carry out all the biological processes in the body smoothly the cells need to make…
Q: Select All That Apply: Streptococcus can be found in this staining. O Diplococcus can be found in…
A: Bacteria are small unicellular organisms. They are found all over the world . Some of them can…
Q: In osmosis, water moves from a _____ concentration to a _____ lower concentration. Select one:…
A: Osmosis is a vital biological process with multiple functions:For example, it influences nutrient…
Step by step
Solved in 3 steps
- Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).After salivary gland cells from Drosophila are isolatedand cultured in the presence of radioactive thymidylic acid,autoradiography is performed, revealing the presence ofthymidine within polytene chromosomes. Predict the distributionof the grains along the chromosomes.
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________Describe the structure of nucleosome ( please keep it short as much as you can ) .Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependent manner. By comparison, many other proteins do interact with nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What information do you know based onthe question…Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?