For each of the following diagrams, name the type of transport happening. Then give the reason you picked that type of transport! Make sure you give as many details in your reason as you're able! 1. Type of Transport: Reasoning: 2. Type of transport: Reasoning:

For each of the following diagrams, name the type of transport happening. Then give the reason you picked that type of transport! Make sure you give as many details in your reason as you're able! 1. Type of Transport: Reasoning: 2. Type of transport: Reasoning:

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter4: Energy And Metabolism

Section: Chapter Questions

Problem 13SQ: A transport protein requires ATP to pump sodium ions across a membrane. This is a case of ______. a....

See similar textbooks

Related questions

Q: Please check all the proteins that would likely have a nuclear localization sequence: Histones TATA…

A: Nuclear localisation sequence in short 'NLS' is an amino acid sequence which tags a protein for…

Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…

A: Introduction The traits of a living organism are determined by its genotype. These traits are…

Q: The term archaic Homo refers to a. Homo erectus / H. ergaster b. archaic Homo sapiens c. Homo…

A: INTRODUCTION Archaic human : human species seen between Homo erectus and Homo sapiens.

Q: C. In a horse population, three different traits showing continuous distribution were measured, and…

A: A measure called heritability is used in breeding and genetics to determine how much phenotypic…

Q: Many cells face serious difficulty living in a hypotonic environment and adapt in various ways to…

A: Turgor pressure is the hydrostatic pressure that can accumulate in living, walled cells when it…

Q: During capillary exchange, which of the following occurs only at the arterial end of a capillary?

A: Introduction Capillaries are extremely narrow (less than 1 mm long), microscopic tube with one cell…

Q: Determine the experimental design that makes the difference between the given two modes of action at…

A: The antisense ribonucleic acid is a type of single-stranded ribonucleic acid molecule that binds to…

Q: Fill in the Blanks Type your answers in all of the blanks and submit. X₂ Compare the life cycles of…

A: The plant kingdom is mainly divided into five divisions that are- algae, bryophyta, pteridophyta,…

Q: A. Glycolysis C. Cellular Respiration (aerobic) D. Krebs Cycle Answer, B. Fermentation E. Electron…

A: As per our company policy, we have to solve three sub parts in case of multiple sub parts. If you…

Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…

A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…

Q: All mutations that abolish function of the Rho termination protein in E. coli are conditional…

A: Conditional mutations are those that prevent the Rho termination protein from functioning in E.…

Q: All signaling molecules bind to receptors on the cell surface. Select an answer and submit. For…

A: Ligand molecules are signalling molecules that basically interact with another molecules and…

Q: Normally when a person consumes a product that contains lactose (such as milk or cheese), the body…

A: Galactose to glucose conversion in the body is hampered by galactosemia, a rare, inherited condition…

Q: ist the inhibitors and activators of the Pyruvate Dehydrogenase Complex observed in most species?

A: Pyruvate dehydrogenase (PDH) complex is a multi-enzyme complex and catalyzes conversion of pyruvate…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: Introduction : Peripheral proteins are discovered resting on the surface, whereas integral membrane…

Q: The figure illustrates the Sulphur cycle. True or false

A: Biogeochemical cycle is a cyclic pathway in which atoms or other elements are introduced, circulated…

Q: ㅇㅁ ㅁㅁ 이미 ㅇㅇㅇ 움 In the pedigree shown, indicate whether each of the following inheritance patterns is…

A: The given pedigree has the following features: i) skips generation: affected children have both…

Q: Which of the following is the most important factor in the development of acne? A. Bacteria B.…

A: acne is developed when the tiny pores of skin became blocked by dirt, oil and bacteria . the sebum…

Q: State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the…

A: The end of a DNA fragment ending with BamHi has a 50% chance of making BamHi junction and 25%…

Q: Modern Homo sapiens are not the only species to use tools. Which other animals use tools? a. some…

A: Introduction: Tool use by animals is a phenomenon in which an animal uses any different kind of…

Q: Which of the following is NOT TRUE about Eukaryotic Transcription: A. Occurs in the cytoplasm B. Pol…

A: Introduction Eukaryotic transcription is the complex process by which eukaryotic cells transcribe…

Q: What is the name of the inverted mini tube inside the larger test tube? Simmons tube Malachite tube…

A: Test tubes These are pieces of laboratory glassware that have finger-like length of glasshold and…

Q: A B D C

A: A Removable Partial Denture(RPD) is basically a denture for a partially edentulous patient who have…

Q: Which is the best possible hypothesis for explaining changes in cortical robusticity over time? a.…

A: The correct option is: The Increasing cortical robusticity associated with appearanceof morden…

Q: Plant breeders have long appreciated the phenomenon called hybrid vigor or heterosis, in which…

A: Cytoplasmic male sterility (CMS) in corn is caused by defective mitochondrial genomes that impede…

Q: Determine the process that can be performed to distinguish the genes involved in general stress…

A: Finding the genes that are activated or inactive in response to osmolarity variations requires…

Q: explain what does hisatmine and adetycholine mimic. within smooth muscle receptors. what do they…

A: Histamine is an important chemical that has a role in a number of different bodily processes. It…

Q: What happens during the regeneration stage of the Calvin Cycle? Energy from ATP and electrons from…

A: The stroma of chloroplasts in a plant cell undergo a sequence of processes known as the Calvin…

Q: Examine and describe the drop shapes which land on a plate and wax paper. Explain the difference in…

A: Water is an inorganic, transparent, tasteless, odourless, and colourless substance. It is the main…

Q: Flippases are enzymes which flip proteins from one face of the phospholipid bilayer to the other…

A: Phospholipid bilayer A hydrophilic exterior and a hydrophobic interior make up the two phospholipid…

Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: Describe the lac operon

A: Lac operon, this concept was proposed by Jacob and Monod in 1965. An operon is a functioning unit of…

Q: In your own words, give the components of the following body system and the functions of each…

A: The respiratory system is the organs and other parts of our body involved in breathing, when we…

Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…

A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…

Q: Q9. Here is a hypothetical evolutionary tree showing domestic and wild pigeon populations. If this…

A: Introduction Phylogenetic tree is also known as dendrogram. It is a diagram that shows the…

Q: Which among the following statements is INCORRECT? The first event in the Calvin cycle is the…

A: Calvin pathway occurs in all photosynthetic plants, that is operated in cyclic manner. Calvin cycle…

Q: Which female could be the mother of the child and why? Which male could be the father of the child…

A: There are several ways to identify the mother of a child from VNTR loci. One way is to look at the…

Q: Which of the following is NOT involved in oxygen production in photosynthesis? Photosystem I O Light…

A: Introduction : Autotrophic plants produce their own food through a process called photosynthesis.…

Q: Hemophilia, disease in which the blood lacks a clotting factor, is caused by an X linked recessive…

A: Introduction:- A pedigree is a family tree that uses symbols and lines to demonstrate genetic family…

Q: please reflect on the three major subject areas 1. Evolution - including evolutionary processes,…

A: 1 evolution--Evolution is a change in the genetic composition of a population over successive…

Q: If you experimentally removed the histones from the cells you are growing in your lab, how would…

A: Histones are extremely basic proteins which are located in the nucleus of eukaryotic cells and are…

Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…

A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…

Q: Tautomerization: A. Causes frameshift insertions B. Causes frameshift deletions C. Results in…

A: Introduction : Mutation is the term used to describe an abrupt change in genetic makeup. DNA…

Q: If phenotype is a proxy for genotype, then why do you think that paleoanthropologists erroneously…

A: introduction : The knowledge that our ancestors very likely ocassionaly mated successfully with…

Q: Briefly explain the difference between a food chain and a food web

A: Answer: Ecosystem is the circle of full food chains and food webs, where livings things are…

Q: Which of the following is UNTRUE with regards to human gametes and their production: A. Female…

A: A. Female gametes complete Meiosis II only after fertilization - true Explanation - Oogenesis• Each…

Q: What are some affordances of visual mediums?

A: Visual mediums are of many types like digital and printed images, posters, photography, graphic…

Q: Johnny has just been infected and needs your help in letting him know how his body is fighting the…

A: The main function of immune system is to distinguish between self and non sell. its primary function…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Tell me the type of transport based on the following diagrams

For each of the following diagrams, name the type of transport happening. Then give the reason you picked that
type of transport! Make sure you give as many details in your reason as you're able!
Type of Transport:
Reasoning:
2.
Type of transport:
Reasoning:

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following best describes diffusion (passive transport)? Group of answer choices: Net movement of molecules from an area of low concentration to an area of high concentration. Net movement of fluids from the environment into and out of an organism. Net movement of molecules from an area of high concentration to an area of low concentration. Net movement of molecules between cells.
Which of the following statements is TRUE of diffusion? Diffusion of particles along the concentration gradient will occur until particles are equally distributed in all areas of the solution. Diffusion of particles along the concentration gradient will occur until the particles move fully from one side of the solution to the other. Diffusion of particles against the concentration gradient will occur until random motion occurs. Diffusion of particles against the concentration gradient will occur until all the particles have dissolved. Carl is examining an onion root tip cell under a microscope. Based on his observations, Carl proposes that the onion root tip cell has completed interphase and is now in the first phase of mitosis. Which of the following pieces of evidence would best support Crisanto’s claim? The cell’s chromosomes are aligned across the metaphase plate. Separated sister chromatids are being pulled towards…
What type of function is performed by the sodium potassium pump (Na+K+ATPase), which directly uses ATP to move sodium and potassium against their concentration gradient? Group of answer choices Secondary active transport Facilitated diffusion Simple diffusion Primary active transport
Which of the following is true regarding bulk transport? ATP is required to pump molecules against the concentration gradient Bulk transport is an example of passive transport Transport of large quantities of materials ATP changes the shape of a protein channel during active transport
Which of the following is correctly paired? Two answer choices are correct. osmosis= a type of active transport facillitated diffusion = a transport proteins are used to move substances across a membrane diffusion = a type of passive transport
A transport protein requires ATP to pump sodium ions across a membrane. This is a case of ______. a. passive transport b. active transport c. facilitated diffusion d. a and c
Types of transport based on energy: 1. Simple diffusion: 2. Facilitated diffusion or passive transport: 3. Active transport Types of transport based on membrane transport proteins: 1. Channels vs transporter/pumps
What type of function is performed by the sodium potassium pump, which directly uses ATP to move sodium and potassium against their concentration gradient? Group of answer choices Primary active transport Secondary active transport Facilitated diffusion Simple diffusion
What is another way to answer this question Describe various examples of active transport. How is active transport different from passive transport? Without saying this: Active transport is when cells move against the flow/ concentration gradient, moving from low concentrations to high concentrations. Because of this, active transport requires ATP to work. Passive transport is different because it doesn't use much energy and moves from high concentration to a low concentration. Some examples of active transport are the Sodium-potassium pump ( the most well known one) where it takes sodium ions and pumps them outside of the membrane to let in potassium ions. Another one in plants is when a plant receives ions from the soil. The soil has a much lower concentration of ions than a plants root does, so ions have to move against the concentration gradient. Endocytosis and exocytosis are also forms of active transport. Where cells engulf its self around large molecules to bring…
List various types of transport and give example of each in biology
Make a table and summarize the 5 types of transport mechanisms (passive transport, facilitated diffusion, primary active transport, symporter, antiporter) and compare them in terms of the following: - Electrochemical gradient (downhill/uphill) - Carrier-mediated or Not - Metabolic Energy
Which one of the following pieces of evidence would prove that a substance enters a cell by.active rather than passive transport? The substance being moved is water The substance enters the cell by going down its gradient The breakdown of ATP is needed The substance is moved across the cell membrane by a carrier protein