For anabolic pathways, all are required except Select one: a. To combine small molecules O b. it is a divergent process Oc. Often involve reductions in which the reducing power is most frequently provided by the electron donor NAD* Od. Reactions require energy
Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…
A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: QUESTION 5 Using SP-Sepharose as ion exhange resin, indicate the starting and ending pH for the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Fractional saturation(Y) is the ratio of concentration of protein-ligand complex to total…
Q: Promote platelet aggregation and smooth muscle contraction…
A: PGH2 : Prostaglandin H2 TxB2 - Thromboxane B2
Q: Transcription in eukaryotic cells which is resistant to α-amanitin is carried out by which RNA…
A: RNA ploymerase arr the enzymes that synthesize RNA by reading the DNA strand. It copies DNA sequence…
Q: Which of the following methods can be used to regulate the activity of cyclin-dependent kinases…
A: CDK are the protein kinase which are involved in the regulation of cell cycle.
Q: -Inhibitor +Inhibitor _[S] (mM) νο&νβσπ:(μmol/sec) ν0&νβσπ; &νβσπ;(μmol/sec) 0.0001 33 17 0.0005 71…
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: a. Name the phosphoinositide generated through the action of PI-5 kinase. b. Name the products…
A: Phosphatidylinositol (PI)-related signalling is important for survival, cell proliferation,…
Q: Glucose are stored in the form of glycogen and any excess will be stored in the form of…
A: During triacylglycerol synthesis, fatty acids are linked to three alcohol groups in glycerol via an…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: Which of the following is true about cell potential? a. It is the sum of the oxidation and reduction…
A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: What are the description of the ff? A. Enzyme influence on reaction velocity B. Effect of…
A: Enzymes are biological catalysts (also called biocatalysts) that accelerate biochemical reactions in…
Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: what is the importance of studying the variety, sequences, and amounts of mRNA produced in the cell?
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all of…
Q: H3C H3C. HyC O Triglyceride O Fatty acid Glycerol
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Nutrition Facts Calories 112 Total Fat 0g Total Carbohydrates 21 g Protein 7g What percentage of the…
A: Introduction: Calories are the amount of energy or heat that takes to raise the temperature of one…
Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Some enzymes can be inhibited by high concentrations of their substrates. I expression for the rate…
A: In the biological systems , enzymes acts as catalysts . Enzyme help to accelerate the reactions.…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: Question 17 Which of the following is a fatty acid with this notation, 16:0 O Myristic acid Stearic…
A: In a fatty acid the notation x:y is represented by an integer where x is the number of carbon in the…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: 3. Based on the name of the following hypothetical drug salts, which of the following statements is…
A: The given options of hypothetical drug can be described as below in terms of acid and base:…
Q: All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E°' for NAD+/NADH is -0.32…
A: NADH/FADH2 are also known as reducing equivalents. These reducing equivalents are produced in the…
Q: Choose two amino acid and explain the metabolism.
A: Introduction: Amino acids are molecules that contain an amine and carboxylic group with side-chain…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: Acetyt CoA Oxaloscetate CoA NADH Citrate NAD Isocitrate Malste Pumarate NAD NADH FADH, FAD a-…
A: TCA cycle is the tricarboxylic acid cycle which is second step in cellular respiration that occurs…
Q: 12. Polenske value of fatty acid indicates A. how much unsaturation is there in the fatty acid B.…
A: Volatile fatty acid : Linear small(short chain) aliphatic mono-carboxylate compound, like the acetic…
Q: What is the most stable nitrogenous base pairing?
A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: Enumerate the main structural features of nucleosides and nucleotides
A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic…
Q: Please discuss any two of the structures and functions of these 4 molecules. What do they have in…
A: 1. Main carbohydrate storage in plants. 2. Monomer - Alpha glucose 3. 1,4 -glycosidic bond in…
Q: Draw the structure of alpha-ketoglutarate that is generated in a reaction catalyzed by glutamate…
A: Glutamate dehydrogenase (GDH) catalyzes the conversion of glutamate into α-ketoglutarate. The enzyme…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…
A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…
Q: When the blood glucose is low, insulin is released from the pancreas to maintain glucose…
A: Insulin is a polypeptide hormone produced by the beta-cells of the islets of Langerhans (of…
Q: Match the following descriptions to the given choices. Enzyme involved in the conversion of…
A: The above match the following is from an important pathway involving the biosynthesis of…
Q: 4) Complete hydrogenation of TAG (Y) above would yield a TAG of what fatty acid composition?…
A: In the given table, fatty acid composition of three Tri-acyl Glycerol is given: TAG(X) =…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: In given Questions many statement given about glycolysis cycle.Glycolysis is the metabolic pathway…
Q: Topic: Photosynthesis Hi. I'm having trouble determining the answer to this question. I would like…
A: Photosynthesis is an anabolic process in which the carbohydrates are synthesized by using carbon…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: lood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. O True O…
A: Introduction: The ABO blood group system is the most common blood type system in human blood…
Step by step
Solved in 2 steps
- Which of the following statements are true? Explain. I. ATP synthesis will cease to occur when the electron flow is blocked by cyanide. II. 2,4-DNP allows electron flow to continue in the ETC without the synthesis of ATP. III. -ΔG is the quantity that signifies that the reaction is SPONTANEOUS.= Cellular Respiration Glucose (Cs) 2 G3P (Cs) 2 U Cs) 2 GTP- GDP (Cs) 2 acetyl CoA (___Cs) 1½/202 iii H₂O iv 2 Fill out the diagram as indicated by instructions below. Label processes g. A, B, and C. h. Some reactions are labeled with numbers in blue ovals. (Some of these are "collected" reactions, i.e. they stand for all reactions of the same type that occur in the same part of the pathway.) Among these reactions, write in reactants and products for all reactions that involve ATP and ADP. i. Reactions 6 and 8 involve FADH₂. Write in reactants and products for these reactions. j. Among the reactions labeled with numbers in blue ovals, write in reactants and products for all reactions that involve NAD+ and NADH. k. Below, write in the molecules that correspond to each of the following labels (iv is a molecule moving through the protein, indicated with an arrow): i: ii: iii: iv: 1. The blank in front of molecule (i) that you identified above is to indicate how many copies of this…Which one of the following standard rate constants would have the lowest value and why? O k3 since it is separated by the highest activation energy barrier and limits the overall catalytic rate since it separates E from P O k-1 since it is separated by the highest activation energy barrier and limits the overall catalytic rate through a back reaction O k2 since it is separated by the highest activation energy barrier and limits the overall catalytic rate by producing product k1 since it is separated by the highest activation energy barrier and limits the overall catalytic rate since it forms ES
- Consider the function of the cofactor FAD. Which of the following makes it unique (different) from NAD+? Select all that apply. a. Can facilitate single electron transfers b. Is associated with an enzyme and not a mobile electron carrier c. Serves to facilitate redox reactions d. s an electron carrier in the TCA cycleComplete the following diagram, using arrows to show the flow of electrons, for this reaction catalyzed by GAP dehydrogenase. Draw how the enzyme pocket appears as the reaction is completed. Indicate the product (if any). NAD+ ÇHOPO он СysWo reactions below and determine if they are exergonic or endergonic reactions + reactants 1. Label the molecules and identify this process Glucose + Oxygen -> ATP + Carbon Dioxide + Water 2. Summarize this process: M 3. Write the balanced equation for this process: 4. Is this process an exergonic or endergonic reaction? Why? O Search ATP energy OCO OCC OGO OGO Cell Respiration + products 8
- 2. a) Energetics of the electron transport. In the oxidative phase of oxidative phosphorylation, electrons are passed from NADH and ultimately to molecular oxygen through an electron transport chain comprised of multiple redox centers. Assume that an electron is passed through the chain along the route shown below. Clearly, there are steps missing, but we will skip those to emphasize the energetics of the electron transport. Calculate DE' and DGº' for each electron transfer step and record the values in the table. The reduction potentials for each of the redox centers are given in table 11.1. (F=96.4 kJ/V mol) Route: NADH → (Fe-S)N-5,6 Coenzyme Q → Cytochrome c₁ → Cytochrome a3 ⇒ 0₂ Table 11.1 STANDARD REDUCTION POTENTIALS (E°') FOR SELECTED ELECTRON CARRIERS IN THE ELECTRON TRANSPORT SYSTEM Electron carriers NAD+ + H+ + 2e → NADH Complex I (NADH-ubiquinone oxidoreductase) Fe-S (N-1b) Fe-S (N-3,4) Fe-S (N-5,6) Complex II (succinate dehydrogenase) FAD + 2H+ + 2e → FADH₂ (enzyme bound)…Given the conditions below A (Enz A)→ B-(Enz B) C (Enz C) D (Enz D) →E Enzyme Reaction Rate @ Q1o Reaction Rate at 20 C 30 C A 1.38 1.68 1.44 2.78 C 1.23 1.84 1.58 1.96 If tissue D exhibits a reaction rate of 1.58 umol CO2 gFW-1 hr-1 at 20 C and has a Q10 of 1.96, what is the reaction rate at 30 C?(Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would be the best coenzymes to use for the two steps in the scheme, and why? в CO2H R SCOA R
- Bypass reaction in the anabolic pathway often occurs when A The ΔG of the reverse reaction in the catabolic pathway has a large negative value B The ΔG of the reverse reaction in the catabolic pathway has a large positive value C The ΔG of the reaction in the anabolic pathway is close to zero D The ΔG of the reaction in the anabolic pathway is positive E None of the aboveComplex No.3 named: Select one: O a. succinate dehydrogenase Ob. NADH dehydrogenases c. Cytochrome a+a3 Od. cytochromes bc,Identify any coupled reactions and what processes are coupled together. a. oxidation/reduction reactions: determine what is being oxidized and what is being reduced. b. energy transfer: determine which is exergonic and which is endergonic Are there any coupled reactions. If so, which ones are coupled. In the oxidation reduction reactions identify what is being oxidized and what is being reduced. Which are exergonic and which is enderdorgonic
