F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA contains the sequence (5) СТТААСАССССТGAСТТСGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5' end? а.
Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…
A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…
Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…
A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…
A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: 5. The pioneering work of Paul Berg, Herbert Boyer, and Stanley Cohen in the early 1970s led to the…
A: Insulin, a peptide hormone produced by the β-cells of the pancreas and is a regulatory hormone for…
Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…
A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…
Q: 11) Which of the following characteristics is directly related to the coding of a single amino acid…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…
A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…
Q: Genotype Condition Functional Nonfunctional No Enzyme Made Enzyme Made Enzyme Made I'OʻZ" No Lactose…
A: The prokaryotic gene regulation system is known as operon system that controls the expression of a…
Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…
A: Need to find which of the following is correct regarding RNA polymerase function.
Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…
A: Mutations are changes that occur in the nucleotide sequence of DNA. The mutations can be somatic,…
Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…
A: DNA is the genetic material as it contains all the information required to make all the proteins and…
Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…
A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…
Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…
A: The DNA is transformed into proteins through the process of transcription and translation. The…
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…
A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…
Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…
A: The replication, transcription and translation are the very important processes in cell biology that…
Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…
A: "Transcription" and "Translation" are two important processes that take place inside the cell for…
Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…
A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'
Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Promoter sequence is present in the DNA at the upstream of regulatory gene.
Q: 5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C.…
A: All these terms are related to DNA, mRNA and tRNA. DNA stands for deoxyribonucleic acid. RNA stands…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…
Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…
A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…
Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: 2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they…
A: Introduction : Through transcription process RNA synthesized from DNA. After that RNA processing…
Q: 6) There is clear evidence that chromatin state is directly related to the ability of proteins to…
A: The chromosomes appear as a mass of greatly fine tangled string called "chromatin." Chromatin is…
Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…
A: Since you have asked multiple questions, we will answer first question for you. In order to get…
Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…
A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…
Q: 90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the…
A: Ribonucleic Acid ( RNA ) -- Ribonucleic acid is also a type of nucleic acid found in the living…
Q: 3. Finally, directly below the mRNA sequence that you wrote for #2, write the amino acid sequence of…
A: The DNA sequence given in the question would act as a coding stand for the synthesis of mRNA. The…
Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…
A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu
Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…
A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…
Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…
A:
Q: The process of attaching biological functions to DNA sequences is called?
A: DNA is present inside the nucleus.
Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…
A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…
A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…
Q: 5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the…
A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid and Deoxyribonucleic…
Q: 5. Compare and contrast transcription and translation. Transcription Translation What is the Start…
A: The central dogma of molecular biology explains the conversion of genetic information from DNA to…
Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…
A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…
Q: 1) Transcription and translation both involve an initiation, elongation, and termination phase.…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: The role of mRNA in protein synthesis is that it ____.
A: Proteins synthesis is the most important essential and significant metabolic activity of the living…
Q: 4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The…
A: Given, Question in Item 2: The complementary strand from item 1 undergoes transcription. What will…
Step by step
Solved in 4 steps
- Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
- Mutated DNA Sequence #3 TACAC CT TAG C GACGACT... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein coding mRNA including the untranslated regions (UTRS) Сap 5' UTR Coding sequence (CDS) Poly-A tail 3' UTR Start Stop 5' 3' Question 1: Which of the following mutations may result in synthesis of a non- functional protein? A. Silent mutation in the coding sequence. B. Missense mutation in the coding sequence C. Deletion of four bases in the 5'-UTR D. Deletion of four bases in the 3'-UTRTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
- All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the pre-mRNA B. lariat formation is necessary to bring the branch site with the 5' splice site of the intron C. an unstable 5'P and 2'OH phosphodiester bond helps form the lariat D. exon 5' splice site consensus sequence GU and its 3' splice site AG are recognized by snRNPs E. various types of snRNPs and the pre-RNA come together to form the spliceosome A, B, C, E only A, B, C, D, E A, B, C only B, C, D, E onlyAll about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the pre-mRNA B. lariat formation is necessary to bring the branch site with the 5' splice site of the intron C. an unstable 5'P and 2'OH phosphodiester bond helps form the lariat D. exon 5' splice site consensus sequence GU and its 3' splice site AG are recognized by snRNPs E. various types of snRNPs and the pre-RNA come together to form the spliceosome B, C, D, E only A, B, C, E only A, B, C, D, E A, B, C onlyDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
