Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…
A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG
Q: Match description with Term: 1) determine the amount of protein in a sample 2) determine the…
A: Recombinant DNA technology is a method by which several different genes can be combined from two…
Q: This question is not assk seperate, you not finfished it.
A: Inheritance pattern is a phenomenon which determines how traits are transferred from parental…
Q: A client fell 2 days ago; he has a compound fracture of his left tibia. The physician performed an…
A: A damaged bone can be stabilised and healed using a procedure called open reduction and internal…
Q: Using an online search, find if ultraviolet light can "kill" SARS-CoV-2. If so, which type(s) of UV…
A: Note:- Sorry, As per the honor code we aren't allowed to cite external references. Thank you!…
Q: You eat a bran muffin topped with brown sugar for breakfast. Summarize the process of carbohydrate…
A: The gastrointestinal tract and other digestive organs make up the human digestive system. Food is…
Q: In detail explain how C3 plant leaf is different from C4 plant leaf and why
A: INTRODUCTION the difference between C3 and C4 plant leaves explained below.
Q: Sperm motility is one of the features of any fertility test. The movement of human sperm is possible…
A: Introduction In anisogamous forms of sexual reproduction, the male reproductive cell, or gamete, is…
Q: Explain translocation, deletions and duplications
A: Chromosome is organized structure of DNA and proteins present in the nucleus of eukaryotic cell.Each…
Q: You have decided to design a CSTR with recycle to degrade TCE (trichloroethylene) cometabolically by…
A: Introduction :- Small, single-celled organisms called bacteria exist. Nearly all areas of the world…
Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…
A: Introduction The parts of a gene that are translated into proteins are called exons. Introns are…
Q: Can only be transmitted to male offspring Equally affects males and females Has 1/2 chance of being…
A: Chromosome linked disease The disease which is inherited to progeny by affected father or mother.
Q: In the diagram below, white represents maternal information and black represents paternal…
A: The cell division is a series of events that produce daughter cells. Mitosis and meiosis are kind of…
Q: Information on DNA can often indicate relatedness between organisms and even provide data on how…
A: The contemporary categorization system uses DNA to actuate an organism's heritage and ancestry, as…
Q: Which of the following enzymes can decatenate replicated bacterial chromosomes? please explain the…
A: Bacterial chromosome is a circular and covalently closed one. Various enzymes are involved in the…
Q: In detail explain all the stages of the Calvin cycle
A: Calvin cycle is also called C3 cycle or dark reaction or light independent reaction. It doesn't…
Q: Q6.1: Under what metabolic conditions are excess carbohydrates be converted to stored…
A: When too much carbohydrate is taken, glucose is transformed into glycogen until the body's limited…
Q: fermentation catabolic or anabolic
A: Introduction: In an anaerobic environment, enzymes are used in the chemical process of fermentation…
Q: A is a dominant gene for normal pigment, and a is its recessive allele for albinism (and pink eyes).…
A: Alleles are the alternative forms of a genes that are located on the same locus of homologous…
Q: What do you understand by “Sequencing by synthesis?” What is FRED score? Give an example.
A: Introduction: The complete DNA sequence of a human being is known as their genome. There are 46…
Q: 15. if you were a physician, how would you treat a female patient with anemia? what tests would you…
A: The RBC or red blood cells are responsible for gaseous transport. It contain hemoglobin has the…
Q: If the resting membrane potential of a cell was +70 mV, the ELECTRICAL driving force on sodium would…
A: A neuron's purpose is to turn the message received from the external environment into an electrical…
Q: Which of the following experiments was used by Twort and d'Herelle to demonstrate the existence of…
A: The two co-discoverers of the "Twort-d'Hérelle Phenomenon," also known as "transmissible lysis of…
Q: Which hormone and condition are mismatched? a. growth hormone-acromegaly b. thyroxine-goiter c.…
A: Hormones act as chemical messengers in our bodies. Proper functioning of the hormonal glands are…
Q: If 400 mL of a 20% w/v solution were diluted to 2 L, what would be the final percentage strength?
A: Dilution is the procedure of lowering a solute's concentration in a solution. It generally only…
Q: In the process of osmosis, the molecules of the solute travel from the solution with higher…
A: We know that osmosis is a process by which the solvents of a solution move from the lower…
Q: Draw a thylakoid disc. Label the following components: Thylakoid membrane Thylakoid space (lumen)…
A:
Q: Describe the key physiological basis explaining how cellular senescence contributes to ageing.
A: Cellular senescence is a key physiological that leads to aging. This is supported by evidence in…
Q: Which micronutrient can be destroyed by chelating agents? O a. selenium Ob.phosphorous Oc. iron…
A: An organic chemical complex known as a chelate is one in which the metal component of the molecule…
Q: when it rains why do we see more worms out?
A: Animal kingdom is a higher kingdom that comprises of eukaryotic organisms. Animal kingdom is…
Q: Prokaryotes were the major life form on Earth for about three Decades Million years Centuries…
A: An entity which is alive, like plants and animals, is referred to as a life form. Over five billion…
Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…
A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…
Q: An abnormal gene on the X-chromosome causes one sister to live with haemophilia A, but her identical…
A: Haemophilia is a bleeding disorder, caused by a mutation in one of the genes, that provides…
Q: Place the following steps of DNA replication in order: Origin melting RNA priming Helicase loading…
A: DNA replication is the process by which the genetic material of a cell is duplicated before the cell…
Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…
A: Introduction Gene expression is the process through which a gene's information is used to create a…
Q: If you have chosen the objective lens with 10x and the ocular lens magnification is also 10x. Then…
A: INTRODUCTION : Objective lens of a compound microscope : A microscope is an instrument which is used…
Q: Discuss physiology of protozoan
A: Protozoans are the unicellular eukaryotic organisms that can be considered as free living or…
Q: All organisms belonging to domains cells. bacteria and protista fungus and bacteria archaea and alga…
A: Prokaryotes are typically tiny, single-celled creatures with a simple structure. The majority of…
Q: In a dividing cell, the duplicated sets of chromosomes move along microtubules to opposite ends of…
A: According to our guideline we can answer only the first question. The second question is completely…
Q: why are the steps in gram staining are so carefully standardized?
A: Gram staining is very useful process that differentiate bacteria on the basis of their cell wall…
Q: What is the biological basis that an Indian woman at the age of 74 gave birth to a child? Is this…
A: Human development demands the right environment, the right conditions, the right time, and a lot of…
Q: Multiple Choice Question: Which of the following sensory structures of insects can detect air- or…
A: Insects are among the most significant animals on the planet. They participate significantly in…
Q: a model that represents action potential and synapses. must explain why
A: Action potential or impulse refers to an electrical or chemical signal that is transmitted along the…
Q: 3. What is the Simpson's Diversity index for the followin What is the Species Richness value for the…
A:
Q: Explain using terms related to equilibrium and free energy why a microorganism that gets its energy…
A: Explanation: - It's possible that a bacterium that receives its energy via a reaction that…
Q: What is supposed to be the function of a lysis buffer? Provide 1 lysis buffer commonly used in DNA…
A: Introduction :- DNA extraction is a technique to separate DNA from cell membranes, proteins, and…
Q: List three common components of microtubules and microfilaments.
A: Microtubules are arranged in the form of microtubule organizing centers. They are structures found…
Q: Charge from depolarization along the axon reaches the axon terminal, but there is a lack of…
A: Neurotransmitters can be defined as a chemical molecules that are involved in the transmission of…
Q: ch of the following could cause cer? Select all that apply. Genetic factors (passed on in families)…
A: Cancer results when the cell division becomes uncontrolled. Lots of cells are produced in a…
Q: how do unicellular differ from single cell multicellular organisms differ
A: Organisms are categorized into different types such as I) on the basis of nuclear membrane/nucleus…
Step by step
Solved in 4 steps
- Please help me solve this experiencee İSTINYE İSÜ ÜNİVERSİTESİ Peptone peptme extrcr İSTİNYE İÜ ÜNİVERSİTESİ LB Boh 5.00d 5.000 STA 2.5L07 LB Barth The apecinet: your LB agar. LB Boxth 2.501 extlact yenst 5.0067 NCl is e Solid media L8 g LB agar 5.0130 Nad Sooml dispillek waher Sg peprone 25g yeast exeracb. Nacl We add 400 ml wkter and mix the mixtule, then. the ph value, before Yest of the amOun. thet we will add Sooml messuing 59 A the ee. no need for heat when we aie miy tuting the Solution magnatic 3 H S.ooL pepane ve Used the Some spAn to put the peprone onAlsmiaure sheea Slale 5.0008:05 PM >* © 11% A docs.google.com yluallw a201031313@alnoor.edu.iq سيتم تسجيل عنوان بريدك الإلكتروني عند إرسال هذا النموذج. مطلوب Q3.Choose the most correct statement from the following Llä 4 The sympathetic nervous system is responsible for the following processes * :EXCEPT Respiration, and sweating. Increase in digestive and urinary function. Blood pressure, heart rate. Increased alertness, metabolic rate. *:The spinal cord has all of the following EXCEPT The outer layer is white &the inner is grey. Is shorter than the spinal column. Has 31 segments. Has no cerebrospinal fluid. Llä 4 * :The cerebellum It coordinates voluntary and involuntary patterns of movements. all the other choices It contains nerve fibers that connect it to every part of the central nervous system. It adjusts muscles to automatically maintain posture. Llä 4 * : Seminal vesicles fluid containspic: 3.1 Discussion Forum с Student Po... X New Tab X ftccollege.instructure.com/courses/19318/discussion_topics/259958 Log In to Canvas Cengage eTextbook + Email | Microsoft 365 3.1 Discussion Forum What is Scatter Radiation and How is it Controlled? Type here to search Instructions 1. After reading chapter 9 from your textbook, you will be able to explain scatter radiation and how it is produced as a result of the attenuation of the x-ray beam by matter. You will also recognize the factors that influence its formation and how to minimize the fog that this radiation causes on radiographs. NCCT Note: Please read the instructions provided in the following links before submitting your entry: . • Participation Rules . Online Etiquette Rules B LM 2. For your participation in the forum, answer the following questions: a. Fog on a radiograph becomes objectionable when one body part size is larger than another. Based on what you read, explain which body part will be objectionable? b. How is…
- File Edit View History Bookmarks Profiles Tab Window Help he X Rev X locx Bev X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline QUESTION 4 A Blac X MAT X W Biol 1406 - LA....docx A JUN 3 Choose all of the true statements below. Hint: 5 statements are true. O Red wavelengths have longer wavelengths and thus lower energy. O When an electron absorbs a photon, it goes from a ground state to an excited state. O Chlorophyll absorbs green light giving plants their green appearance. In photosynthesis, H₂O is reduced and CO2 is oxidized. 24 MAT X Click Save and Submit to save and submit. Click Save All Answers to save all answers. Blac X Blac 83 N. SOL X CollegeScores2y....csv ^ Writ Wri X O Excited electrons move to higher energy orbitals and release energy as they fall back to their ground.state. The Calvin Cycle must turn 2 times to build up one molecule of glucose. The three major stages of the calvin cycle include: carbon fixation, reducation, and regeneration of the CO2 acceptor…A client has been ordered methyl Pprednisulune 30omg luPB In 30mL D5W Over 15 min.stat fur an asthma att-acis. in Stous,you have methylpredrisolune 500mg vials . The reconstitutiun Instructions are: Add 7.8mL G Sterile uater and shale genly Each reconstituted uial contains 8mL. a) Houw nmuch medieation will you draw up? 6) what is the Infusion rate in mt/ hr ?ucation.com/ext/map/index.html?_con=con&external_browser=0&launchUrl=https%253A%252F%252Fbbniagaraccc.sln.suny.edu%252F... ☆ nment Saved Help Albuterol can be administered by nebulizer or inhaler. Each puff of an inhaler contains 0.09 mg of albuterol. How many milligrams are there in a daily maintenance dose of albuterol if 2 puffs are inhaled every 6 hours? Emg
- Place numbers beside the statements below to indicate the order of events occurring in the light reactions. I know for sure that 1 and 8 are correct, but the rest I’m not too confident about. I attached both my work and a blank copy.Could you please help me with my compare and contrast essay. Please see attached the 2 photos. Compare and contrast the Two Different AEROSOL THERAPY PROTOCOL. Thank you.mead. Post Lab #2 Smear & Stain Preparation Name: Leidiawa MontaNo Date: 1. Why are thick or dense smears less likely to provide a good smear preparation for microscopic evaluation? Please explain. Becapse, it will diminish the amount ds latcan Pass through by mam 1t difficult to See under the micioscol e, s less liket to Prowde a go image. 2. What could potentially happen if you leave the slide exposed for too long to the open flame? Why do you have to be careful? we can form ring Patterns if we expose the slide for ta0 the flame 3. During the preparation of a smear leading into simple staining of the bacterial culture S. epidermidis you forgot to heat fix the slide. What would you see on this slide as compared to a slide that was properly prepared? Please explain. 4. You partner stained bacterial cells and saw only the background and not the actual cell was stained. Your partner thought this was a mistake. Please explain what type of staining method this is, how it works and why the…
- BIOL 10 X 0. lit, convert, sign tools chrome-extension://efaidnbmnnnibpcajpcglclefind mkaj/file:///C:/Users/te... e A ONA Lab04 NX Lab Vido X L Your computer / BIOL 109... 4nv (1) (12) Mu X | G pdf 206 X V LCD Obsessi | G Types o x | + □ 7. What muscle is this? CON Desktop W 8. What is the specific insertion of muscle #7? на = 0 O X 110 1 6 ^ - S X Finish update: Shareblackboardcdn.com/5bfc08ba3fldc/14683296?X-Blackboard-Expiration=16245468000008X-Blackboard- 19 / 47 100% 1.4. Functions of the light mlcroscope parts Complete the following table by writing the function(s) of each of the parts indicated. Structure Function Diaphragm / iris Stage opehing Lamp Objective lenses Eye piece Coarse and find adjustment knobs Stage Stage rack prt sc delete home backspace lock enter pause t shifthttps://www.youtube.com/watch?time_continue=2&v=B_lHQSxz9GI&feature=emb_logo Using what you’ve learned from the video, answer the following questions in the spaces provided.1 Death is a major event not only for the person who dies but also for the microbes that inhabit their body. Which of the following statements best describes why? a. All the microbes that were living inside the person’s body die when the person dies. b. Microbial populations grow and spread to different areas of the body after the person dies. c. Microbes in the body have fewer resources after the person dies, which increases competition. 2 Which of the following statements about cadavers (dead bodies) is most likely to be true? a. Microbial communities in and around a cadaver change over time. b. Samples taken from different cadavers always contain the same microbes. c. The microbial community found in a cadaver is very similar to the one found in a living body. 3 After death, gases build up inside the…