Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area = base X height. - Circle area = radius². - Trapezoid area = (base 1 + base,)X height. %3D Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon"), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: base,, base, and height, or), in which case RuntimeError exception should be raised and the processing should continue. Triangle: 50 48 Shape Area Circle: -10 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area = base X height. - Circle area = radius². - Trapezoid area = (base 1 + base,)X height. %3D Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon"), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: base,, base, and height, or), in which case RuntimeError exception should be raised and the processing should continue. Triangle: 50 48 Shape Area Circle: -10 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter9: Records (struct)

Section: Chapter Questions

Problem 2PE

See similar textbooks

Similar questions

In C language, create a program that uses a standardized input method (input file with From To and Weight defined) to read in a text file. The text file will contain the name of the building and the distance from each building when running the program with the file, the program will read the information above and will ask users which buildings are they in and where they want to go to find the shortest path. then it will display the shortest route and the distance from the building that the user is at to the building that the user wants to go to
Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area = base X height. - Circle area =n radius². - Trapezoid area = (base 1 + base,)X height. Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon’), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: base,, base, and height, or), in which case RuntimeError exception should be raised and the processing should continue. Triangle: 50 48 Shape Area Circle: -10 Triangle Circle Trapezoid: 10 12 70 1200.00 >> invalid dimension 770.00 Trapezoid: 9 32 Trapezoid Trapezoid >> missing data. Sample input file Sample output
PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.
A python function opens file data.csv, reads the data from the file and spits the data into three columns, x, y and z. The data is then printed out. Function: f = open("data.csv ", "r") print('x\ty\tz'.format()) for row in f: temp = row.split(',') for cell in temp: print(cell,end='\t') print() data.csv contains: 1.2,2.1,1.1 2.3,3.2,0.6 0.7,1.9,0.1 1.8,2.5,0.3 4.6,2.7,0.9
Code should be in Python. Given a text file containing the availability of food items, write a program that reads the information from the text file and outputs the available food items. The program first reads the name of the text file from the user. The program then reads the text file, stores the information into four separate lists, and outputs the available food items in the following format: name (category) -- description Assume the text file contains the category, name, description, and availability of at least one food item, separated by a tab character ('\t'). (Examples in image)
A company stores payment information for their employee working on a project and paid on a project basis, in a text file whose name is entered through keyboard (see a sample input file below). The first line of the file indicates the number of employees and each subsequent line corresponds to information related to an employce payment (employee name, number of hours worked and his/her hourly wage). Write a python program that reads such a file and displays the employees' names, their hours worked, and their salaries. Finally, it displays the total Your program should consider the following erroncous cases: рaуmеnt. • The file does not open/exist The format of the data in the file is incorrect (e.g. hours = "1-" or salary = "unkown") in which case a RuntimeError exception should be raised and the processing should continue Enter input filename: employees.txt Employee Hours Salary Badria Al-Harthi: 11 Youcef Al-Busaidi: 19 720 Salim Al-Hajri: Majid Al-Sinani: Amer Al-Shidani: 10 unkown.…
Problem Definition Task. Your task is to develop a python program that reads input from text file and finds if the alphanumeric sequence in each line of the provided input file is valid for Omani car license plate. The rules for valid sequences for car plates in Oman are as follows: Each sequence is composed of 1 to 5 digits followed by one or two letters. Digits cannot start with 0, for instance, 00, 011, or 09 are not valid digit sequences. The following list are the only valid letter combinations: ['A','AA','AB','AD','AR','AM','AW",'AY"', 'B', BA','BB','BD',"BR','BM',"BW',"BY', 'D','DA','DD','DR','DW','DY', 'R','RA','RR','RM','RW','RY', 'S','SS', 'M','MA','MB','MM','MW','MY", "W',"WA',WB',"wW', Y,YA','YB','YD','YR','YW',YY] Program Input/Output. Your program should read input from a file named plates.txt and write lines with valid sequences to a file named valid.txt. Any line from the input file containing invalid sequence should be written to a file named invalid.txt. Each line…
Can i get help writing this program in c++ on microsoft visual 19 with this input file incorporated. The client should read in the file contents and store them in the object. The file will be formatted such that the first line contains the month name, the second line contains the year, and each successive line contains a temperature. A typical input file might contain: June 2019 90 85 97 91 87 86 88 82 83 85
Problem A straight line can be defined by a pair of points p1(x1, yı) and p2(x2, y2). The slope m of a line is defined as follow: У2 — У1 m = X2 - X1 Your program reads the points from a text file called 'points.txt’ which contains the coordinates of unknown number of pairs of points as shown in Figure 1. Each line contains four values x1, y1, x2, y2, where x1, yl are the coordinates of the first point and x2, y2 are the coordinates of the second point. 10 -2 7.5 -3.2 4 15.5 -4.6 21 -2 Зр 12.5 6. 2 5 -3 -6 10 3 10 15 Figure 1. Input file contains unknown number of point pairs Use Spider, to create the following files: (i) The input file 'points.txt' shown in Figure 1. Your Python program that reads from the input file 'points.txt', the coordinates of unknown number of pairs of points, computes the corresponding slopes then prints the results on the screen as shown in Figure 2. (ii) Line # X1 Y1 X2 Y2 slope 1 10.00 -2.00 7.50 -3.20 0.48 2 4.00 15.50 -4.60 21.00 -0.64 3 0.00 0.00 0.00…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
Please use python not java or C++ A straight line can be defined by a pair of points p1(x1, y1) and p2(x2, y2). The slope m of a line is defined as follow: ? = ?% − ?' ?% − ?' Your program reads the points from a text file called ‘points.txt’ which contains the coordinates of unknown number of pairs of points as shown in Figure 1. Each line contains four values x1, y1, x2, y2, where x1, y1 are the coordinates of the first point and x2, y2 are the coordinates of the second point. Figure 1. Input file contains unknown number of point pairs Use Spider, to create the following files: (i) The input file ‘points.txt’ shown in Figure 1. (ii) Your Python program that reads from the input file ‘points.txt’, the coordinates of unknown number of pairs of points, computes the corresponding slopes then prints the results on the screen as shown in Figure 2. Figure 2. The output on screen Your program must define and use the following functions: 1. printHeader(...): prints on screen the three lines…