Every cell contains all of the DNA for an organism. What controls when and how specific genes are expressed? Genes are not controlled, all genes are expressed all the time Gene expression is controlled by sequences in the DNA Gene expression is controlled by proteins Gene expression can be controlled by proteins and sequences in the DNA O 000
Q: During transcription ____. the mRNA has been produced through translation is used to make a…
A: The genetic material of an organism is either made up of nucleic acids. DNA is a more stable genetic…
Q: At which of these levels isregulation of gene expression most energy-efficient?
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: What choice best descirbes how genes are used in different cell types in your body. An example of…
A: Gene- Gene term was introduced by Wilhelm Johannsen in 1909 and the definition has been refined many…
Q: The only thing that effects gene expression is if the gene is dominant Choose: A. Yes, all…
A: Gene expression is the process in which genetic information can be interpreted as phenotype. The…
Q: Which of the following is not true of an organism's genotype? Multiple Choice It contains structural…
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…
Q: Which statement is correct? Cells in the muscles have different structure and function than skin…
A: Gene regulation is how a cell control which gene out of a particular genome has to be 'turned on' or…
Q: Which of the following statament is NOT TRUE about gene expression? a. The expression of genes that…
A: Gene expression is the process where cell uses to produce the molecule it needs by reading the…
Q: Gene expression can be viewed at which of the following levels?a. Molecular and cellular levelsb.…
A: Gene expression is a process by which genetic code is converted to functional protein or non-protein…
Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…
A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…
Q: Skin cells and heart cells are so different because they use different genetic codes. have different…
A: The cell is the smallest unit of structure, and its function. They are simple machines that store…
Q: Testosterone is a hormone that affects gene expression. Only some cells in your body are affected by…
A: Testosterone is a type of hormone released by the human body. It’s essentially synthesized in men by…
Q: On gene expression control what are the correct statements? MOLECULAR BIOLOGY basic Eubacteria…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which of the following statements about the DNA in one of your brain cells is true? (A) Most of the…
A: Answer is C.) It is the same as the DNA in one of your liver cells.
Q: Choose ALL of the TRUE statements below. O All animal cells (except gametes and blood cells) contain…
A: Gene expression is the process by which a cell reads the genetic instructions written in DNA through…
Q: CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype
A: The process of synthesis of RNA with the help of template DNA is called transcription. In this…
Q: a decrease in expression. It will cause an increase in expression. It will cause the methylation of…
A: Histone acetylation is the process by which the lysine residues within the N-terminal tail arising…
Q: Q6
A: A mutation is a change in the structure of a gene, which is the fundamental unit of inheritance.…
Q: The genotype is the amount of each protein that is contained within a cell. the observable…
A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…
Q: Alternative RNA splicing is a process which increases the rate of transcription. allows the…
A: Alternative RNA splicing is the process which produces a combination different spliced sites within…
Q: How gene expression is controlled? (min 500 words)
A: The genes are the components of the genome that direct specific functions in the cell. Their…
Q: A promoter: is a small stretch of DNA that binds to proteins that initiate transcription is a small…
A: A promoter is a small stretch of DNA that binds to proteins that initiate transcription.
Q: You have received an opportunity to work with a professor. He wants you to induce a tumor in a model…
A: Model organism are those non human species, which are extensively used in laboratory to test a…
Q: Many human cancers result when a normal gene mutates and leads to uncontrolled growth (a tumor).…
A: Introduction Cancer is a popular disease now a day. In the US, 1 in 2 women and 1 in 3 men develop…
Q: A.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell.…
A: The two statements given in the question are : A.) DNA encodes for the cell genome and is therefore…
Q: What does it mean to say that a gene is expressed? DNA contains the information needed to make a…
A: Numerous cells aggregate to make up the whole body. Cells are the building blocks of the body. Cells…
Q: A DNA sequence looks like this: GAA GAG GGG GCG - Translate it to mRNA - Describe how you have…
A: The conversion of DNA to mRNA is known as translation.
Q: Chronic liver disease is common among HIV-infected patients, and is increasingly a cause of…
A: HIV stands for Human Immunodeficiency Virus. It is a positive strand enveloped RNA virus, belongs to…
Q: Which statement is INCORRECT? (A) Proteins confer structural and functional properties to cells. B…
A: The DNA is the genetic material of most organisms that is a double standard helical structure of…
Q: ct one: a The gene is turned off, but still expresses a protein product. . The gene becomes…
A: DNA methylation is associated with the silencing of gene expression.
Q: Muscle cells are different from nerve cells because they: contain different genes express different…
A: Answer : Option "B" is correct Express Different genes
Q: Diet and lifestyle factors during pregnancy A number of healthy habits are recommended for a…
A: Pregnancy is a wonderful period for most people. Some people may get concerned about what they ought…
Q: Cancer is a disease that results in uncontrolled cell division. Cancer cells have lost their ability…
A: Cancer cells have mutations that inhibit apoptosis and increase cell division to a significant…
Q: Adding methyl groups to DNA.. O increases the amount of protein these genes transcribe and…
A: The bases are ordered in the genetic information-carrying DNA (deoxyribonucleic acid)…
Q: What choice best descirbes how genes are used in different cell types in your body. An example of…
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: The methylation of a promotor: is random; sometimes the promotors are methylated and sometimes…
A: methylation of DNA has been associated with silencing of the gene expression and methylated DNA is…
Q: What describes the DNA of cancer cells? Select all that apply. Often single stranded instead of…
A: Cancer cells are defined as those cells that are different from rest of the cells of the body. These…
Q: 1. (a) RNA polymerase synthesis in a 5 -3 direction Gene is switched ON Gene is switched…
A: RNA synthesis and DNA synthesis both takes place in 5' to 3' direction. But these two synthesis has…
Q: You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You…
A: Introduction: Gene is a unit of heredity. It contains the genetic information. It is made up of DNA.…
Q: Melanin is a skin pigmentation that absorbs and dissipates broadband UV rays. Since UV radiation…
A: UVR is significant environmental factor that affects the function and survival of many cell types,…
Q: A The impact of temperature on gene expression enzymatic differences at different temperatures The…
A: RNA-Seq is a sequencing technique that employs next-generation sequencing to reveal the presence and…
Q: A change in what type of cell is most likely to cause a mutation that can be inheri
A: Ans- A change in sperm cells cause a mutation that can be inherited. Mutations in egg or sperm…
Q: The binding of an enhancer O stimulates transcription of a specific gene. O stimulates splicing of a…
A: The binding of an enchancer stimulates transcription of a specific gene , such as enchancer sequence…
Q: Two genes can be right next to each other on a chromosome but get trån rates and times because it…
A: All organisms are composed of numerous cells. Cells are the functional and the structural units of…
Q: In which tissue(s) is the mRNA and protein highly expressed in? 1. Go to:…
A: As instructed in the above question steps were followed and tissue expression in terms of protein…
Q: Arrange the numbers to show the correct order of events in transcription and translation. In the…
A: In the nucleus of a cell, DNA becomes active by rearrangement of epigenetic factors making genes…
Q: does DNA encode the instructions to make us? Select all the true statements. Group of answer choices…
A: DNA is necessary for all living things, including plants. It plays a role in heredity, protein…
Q: Which of the following statament is NOT TRUE about gene expression? Lütfen birini seçin: O a. Gene…
A: The process of using the information stored in genes to synthesise a functional assembly of a…
Q: A scientist is studying the genetic material that determines the traits of an individual. In which…
A: The study of how heritable characteristics are transferred from parents to offspring is genetics.…
Q: ________ is required to give cells unique specializations
A: Answer - Option C - Gene expression
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following can occur when genes are not expressed properly? it can result in uncontrolled cell growth, forming tumors the DNA of the cell will be destroyed by RNA only the proteins needed by the specific cell are created genes will create carbohydrates instead of proteinsCap, EA1, and Sap are all genes and are also proteins. For each gene, what gene product is encoded and where is the gene aka literal DNA sequence and located physically in the cell? I need help for each one cap what gene product is encoded and location Ea1 what gene product is encoded and location Sap what gene product is encoded and locationYour friend sends you two cancerous cell lines to examine and determine possible mutations. The results are shown below: Cell Line Mutation WT none (wild type DNA) 1 a deletion at the same region on both copies of chromosome 4 a point mutation in a gene on only one copy of chromosome 7 Based on this data, what type of geńe is mutated in each of the cell lines? Select all that apply O Cell line 2 has a mutation in an oncogene Cell line 1 has a mutation in a tumor suppressor gene Cell line 1 has a mutation in an proto-oncogene Cell line 2 has a mutation in a tumor suppressor gene
- DNA regions that are syntenic (i.e., exhibit synteny) between humans and mice would be expected to be which of the following? Pick one. Be expressed in the same type of tissue Be present at some non-chromosomal location such as mitochondrial DNA Have one or more additional copies elsewhere in the genome Have the same genes in the same orderMatch each example of mutation to the correct effect on function. Hypomorphic mutation Hypermorphic mutation Antimorphic mutation Neomorphic A deletion results in the loss of part of a protein and the protein retains some of its normal activity. A mutant allele makes a protein with increased cataytic activity. A mutant form of a transcription factor binds new DNA sequences to activate different genes. A mutant from of a receptor protein interferes with the function of the wild-type receptor through heterodimerization.Some mutations or changes in the sequence of DNA, do not have any offect on the characteristics of the organism. Why Is this? The protein from this mutated sequence deactivated by the cell The mutated sequence still codes for the same amino acid The cell recognizes mutations and ignores them when expressing the gene The immune system repairs the mutated sequence during development
- Which of the following is a method through which cells can control their gene expression? Increase a gene's stability using post-translational modifications Epigenetic modifications of the DNA or histones to regulate DNA avilability phosphorylation of thymidines formation of crosslinks between the DNA strands and the histonesThe following is true about epigenetic gene control: O epigenetic changes to the chromatin may result from childhood development epigenetic changes to the chromatin may result from chemicals in the environment O epigenetic changes to the chromatin may result in cancer O An example of a chromatin change is DNA methylation that prevents gene expression from that area of the DNAAsap
- What is the advantage of using the neo gene to disrupt the function of a gene in knockout mice? The neo gene produces an antibiotic that kills unwanted cells The neo gene produces a toxin that inhibits transcription off the target gene The neo gene facilitates homologous recombination The neo gene is the right size for disabling other genes The neo gene provides a selectable marker for finding cells that contain the disabled geneImprinted genes are A- usually methylated B- methylated and not replicated C- not replicated D- usually methylated and not expressed E- not expressedDystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…