Q: During double fertilization, one sperm will unite with the egg, forming a zygote. As mentioned in…
A: Introduction: In the process of flowering plant reproduction known as double fertilisation, the egg…
Q: Describe the reason that free chlorine-based solutions and technologies are ineffective against…
A: Introduction: The parasite Cryptosporidium parvum is the cause of the severe diarrheal disease…
Q: Which energy system did you use for 5 mins of jogging (around the house or up/down the stairs)? what…
A: Cellular respiration is an important metabolic pathway by which energy in the form of ATP is…
Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…
A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…
Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…
A: A= Sterol group B= Choline C = Glycerol D = Acyl chain
Q: How many meiotic divisions are required to produce 76 seeds in a Guava fruit?
A: Guava: The common tropical fruit guava is grown throughout many tropical and subtropical areas.…
Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…
A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…
Q: Considering both habitat conditions and requirements for successful symbiosis, why should you be…
A: The question is asking about the potential similarities in the microbial symbiots found in two very…
Q: 1. A drug is ordered at 3.5 mg STAT IM. Available vial is labeled 5mg/mL. What volume would be…
A: Drug is a chemical substance which is used by people for getting pleasant feelings. If a chemical…
Q: Extracellular recordings create a distinct action potential. Choose the option that best describes…
A: Action potential is a kind of impulse that arises due to the stimulation of the neuron. It consists…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: A diagrammatic representation of biological entities related via common descent, like species or…
Q: During the action potential waveform, the voltage returns to the resting membrane potential at -70mV…
A: An action potential is a rapid change in the electrical potential of a cell membrane, caused by the…
Q: identify the vegetative propagule of eichormia.
A: Vegetative propagation is the process of asexual reproduction in plants. The process in which new…
Q: Joe went to the emergency room, where he complained of severe pains in the lower right quadrant of…
A: Imaging techniques play a crucial role in the diagnostic process for many medical conditions. These…
Q: What is the bond between water molecules
A: In addition to being exceedingly prevalent in living things, water also possesses several peculiar…
Q: Explain the Life cycle of Plasmodium starting from its entry in the body of female Anopheles till…
A: Plasmodium requires two host for completion of its life cycle a primary and secondary host. That is…
Q: List the steps involved in neurotransmitter release starting with depolarization and ending with…
A: Neurotransmitter release is the process by which a neuron releases chemical messengers called…
Q: explain the difference between commensalism and mutualism types of interaction .
A: Ecological interactions refer to the ways in which different organisms in an ecosystem interact with…
Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…
A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…
Q: Explain how meiosis and fertilisation produce variation within a population.
A: There are several factors that contribute to genetic variation in populations. Natural genetic…
Q: RAE1 molecules are expressed by stressed cells, including some tumor cells. What would be the…
A: RAE1 (Retinoic acid early inducible 1) is a protein that is expressed by stressed cells, including…
Q: Evaluate the nutritional label of a food item, either one in the supermarket or one that you have…
A: This question will evaluate the nutritional label of a food item, specifically potato chips, and…
Q: What is your own definition of morphology?
A: There can be many aspects to examine organisms like morphological,physilogical,pshycological etc.Now…
Q: Explains, with several scientifically detailed information, how global warming affects the beélugas…
A: Global warming is the rise in global mean temperature.Global warming occurs because of increase in…
Q: 2. Large predatory marine fish (ex: tuna, swordfish, marlin, shark, etc.) usually eat at the third…
A: Large predatory marine fish, such as tuna, swordfish, marlin, and shark, are often considered…
Q: Select one specific compound representing a larger metabolite group (e.g. menthol for terpenes),…
A: There are several primary and secondary metabolite secreted from the plant as defense compounds. One…
Q: 1. In pea plants, round seeds (R) are dominant to wrinkled seeds (r). A homozygous dominant plant…
A: The genotypes of a specific cross or breeding experiment are predicted using the Punnett square, a…
Q: Discuss the importance of data when observing something like the outbreak of cholera or even the…
A: The scientific method is a process used in science and research to educate ourselves and find…
Q: What is the purpose of an emulsifying agent? List atleast 5 examples used in pharmaceutical…
A: Emulsifying agent An emulsifying agent also called emulsifier refers to a surface-active ingredient…
Q: A reaction that results in the formation of water as an end product: combustion A reaction that…
A: Amino acids are the building blocks of proteins .Amino acids contain both carboxyl and amino…
Q: All land plants undergo the process of alternation of generations. During this process, individuals…
A: A plentiful amount of water was necessary for the first terrestrial plants to survive. Land plants…
Q: Curator makes a goo (c) Calculate the enthalpy of combustion for ethanol using bond energies and…
A: Burning some materials at high temperatures is referred to as combustion. A gaseous material (smoke)…
Q: How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript?
A: A consensus coding sequence (CDS) is a method used in next-generation sequencing (NGS) to identify…
Q: structure A. Proteins are made up of Each one can be called a and the peptide chain of amino acids…
A: The three-dimensional configuration of an amino acid-chain molecule's atoms is known as protein…
Q: 8. Evolutionary biologists can estimate when major clades probably diverged from each other using…
A: Clade analysis can aid in conservation biology. By understanding the evolutionary history and…
Q: 3. What is the critical role of oxygen in cellular respiration, that without it, aerobic respiration…
A: Cellular respiration: A sequence of chemical processes known as cellular respiration convert glucose…
Q: explain this image for the ecoli bacteria mutation trpE
A: Introduction The trp operon is a type of operon system found in E. coli bacteria. The trp operon…
Q: Medium/test Gram stain TSA Eosin methylene blue agar (EMB) SIM motility agar Brewer's plate in…
A: In microbiology, different tests are used to test the presence of various microorganisms. The…
Q: Of the following choices, which types of cells do not have a cell wall composed of carbohydrates?…
A: Cell wall: It is the tough, flexible or (can be rigid) structure that is present just outside the…
Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…
A: In transcription, the template strand is the strand of DNA that serves as the template for the…
Q: 1. Why do autumn leaves turn yellow and fall?
A: Introduction:- Plants are photosynthetic eukaryotic organisms that can make their food by themselves…
Q: 22. The energy source used in translocation a) ATP b) UTP c) CTP d) GTP
A: A. ATP
Q: 10 ATP/Acetyl-CoA * 2 acetyl-CoA = 20 ATP 1 GTP/ Acetyl-CoA * 2 acetyl-CoA = 2 GTP 1,5 ATP/ FADH2…
A: The process of cellular respiration is a series of reactions that convert the energy from food…
Q: What structure within the mitochondria does the electron transport chain exist? Inner membrane Outer…
A: The creation of power in the form of ATP is the consequence of the crucial Electron Transport Chain…
Q: What are the genotype and phenotype ratios of the potential offspring when a man who is heterozygous…
A: The man is heterozygous for type A blood - IAIB The woman is homozygous for type B blood - IBIB
Q: 19. In the leaves of most plants, where can chloroplasts be found? a. b. C. d. in the upper…
A: A membrane-bound organelle called a plastid, or chloroplast, is a type that primarily facilitates…
Q: Explain how a transcriptional fusion to a reporter gene, combined with site directed mutagenesis,…
A: Studies of gene expression and promoter activity are frequently made easier with the aid of gene…
Q: 4. As an object moves farther away from the eye, how does the lens change to keep the object in…
A: ANSWER) The human has the ability to accomodate the curvature in order to alter the focal length to…
Q: 6. What are carbohydrates? * O Different combinations of amino acids O Lipid monomers held together…
A: Macromolecules are large, complex molecules that are essential to the structure and function of all…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
draw the p21 promoter in a cell with E2F
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- draw the p21 promoter in a cell without E2FChromosomal translocation can result in cells expressing a fusion protein with uncontrolled receptor tyrosine kinase activity due to inability to respond to growth factor ligamds . An example of this type of fusion is: Fos/Jun ErbB/Ras Tel/PDGFR Myc/MaxThe E132:GAL4 construct engineered into a fruit fly will cause
- Describe the effects of the mutation causing the p21 promoter to no longer bind p53 on cell signaling pathways and metabolism or cell cycle control.Expression of S-phase genes is activated when O P16 inactive or absent P16 active Cdk4 inactive O Active Rb bind with E2FDescribe the nature of p53 reactivation as acancer-fighting strategy
- In tumor cells obtained from patients with Burkittlymphoma, a cancer of the immune system’s B cells,the myc gene often appears close to one of the breakpoints of a reciprocal translocation between chromosomes 8 and 14. In this translocated position, myc is expressed at a higher-than-normal level. Scientists hypothesize that Myc protein overexpression in B cellscontributes to lymphoma formation.a. Explain how transgenic mice produced using pronuclear injection could be used to test this hypothesis. (Assume that you previously cloned a generegulatory region that is active specifically in Bcells throughout the life of the mouse.)b. Suppose you wanted to overexpress Myc only inthe immune cells of mice, starting at one week ofage. To restrict Myc transcription spatially, youwill use same promoter described in part (a). Torestrict Myc transcription temporally, you will usea cre transgene whose expression is controlled byheat shock (hs-cre). Describe the mouse you wouldcreate to accomplish…The following chromosomal aberration is found in nearly 90-95% of all patients who have chronic myelogenous leukemia. This is because the change brings the BCR and ABL genes in close proximity. BCR is responsible for cell growth, and ABL is a proto-oncogene... this favors uncontrolled growth. Which is the most accurate description of the aberration... chio moso me 9 Philad elphia chromosome chromosome 22 BCR ABL 22q11.2 (BCR) 9934 1 (ABL) Deletion Translocation Inversion Duplication DELL O O O CWhat is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3
- 23 of 41 Which of the following proteins is NOT encoded by a proto-onoogene? O Myc O Ras O E-cadherin Src O EGF receptorAfter a cell "clears" the G₁ restriction checkpoint, it can proceed into S phase. This S phase entry is achieved by a cyclin dependent kinase (Cdk2) and its cyclin (Cyclin E), but additionally requires the action of a protein kinase (CDC2) as well as a phosphatase (CDC25) enzyme. Explain how these 4 proteins work together to orchestrate S phase entry.Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below? In addition to phosphorylation, the C-terminal domain of p53 can also be acetylated and sumolated in response to DNA damage. Acetylation and sumolation both result in an increase in the transactivation ability of p53 and may account for this finding. In vivo, IR induces the acetylation of p53 at Lys320 by PCAF and Lys382 by CBP/p300. Acetylation at these sites is dependent on N-terminal phosphorylation at Ser15 and to a lesser extent on phosphorylation at Ser6, Ser9, and Thr18 (Saito et al., 2002; Wahl and Carr, 2001). All of these phosphorylation events are ATM-dependent, although only Ser15 has been shown to be phosphorylated directly by ATM. Sumolation occurs at Lys386 after DNA damage (Muller et al., 2000). Sumolation refers to the covalent attachment of a small ubiquitin-like molecule (SUMO-1) to Lys residues, but in contrast to ubiquitination, does not result…