DNA containing the genes gin+ phe+ lys+ was used to transform bacterial cells of genotype gln- phe- lys-. The following cell types were obtained with the number of each cell type shown below: Genotype Number Igin+phe+lys+ 25 gln+|phe-lys- gin phe-lys+ 4. gin-phe+ lys- 14 gin-phe+lys+ gin-phe iys+ gin-phe-tys- 19 Which gene is in the center? Which two genes are the closest together? 2. 00

DNA containing the genes gin+ phe+ lys+ was used to transform bacterial cells of genotype gln- phe- lys-. The following cell types were obtained with the number of each cell type shown below: Genotype Number Igin+phe+lys+ 25 gln+|phe-lys- gin phe-lys+ 4. gin-phe+ lys- 14 gin-phe+lys+ gin-phe iys+ gin-phe-tys- 19 Which gene is in the center? Which two genes are the closest together? 2. 00

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

In the genotype presented (genomic plus plasmid genes), which of the following statements Is phenotype? genome: IS P O`z+Y° plasmid: I* Pt otzY+ no production of either B-gal and permease O B-gal and permease induced when lactose is present no B-gal is produced and expression of permease when lactose is present constitutive expression of B-gal and permease constitutive expression of B-gal and no expression of permease
E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host range, is temperature sensitive, and produces clear plaques (genotype h st c); another strain carries the wildtype alleles (genotype h+ st+ c+). Progeny phages are collected from the lysed cells and are plated on bacteria. The following numbers of different progeny phages are obtained: Progeny phage genotype Number of plaques h+ c+ st+ 321 h c st 338 h+ c st 26 h c+ st+ 30 h+ c st+ 106 h c+ st 110 h+ c+ st 5 h c st+ 6 a. Determine the order of the three genes on the phage chromosome. b. Determine the map distances between the genes. c. Determine the coefficient of coincidence and the interference
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI
Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
An Hfr strain that is hisE+ and pheA+ was mixed with a strain thatis hisE− and pheA−. The conjugation was interrupted and the percentageof recombinants for each gene was determined by streakingon a medium that lacked either histidine or phenylalanine. Thefollowing results were obtained:Determine the map distance (in minutes) between these twogenes.
An Hfr strain that is hisE+ and pheA+ was mixed with a strain thatis hisE− and pheA−. The conjugation was interrupted and the percentageof recombinants for each gene was determined by streakingon a medium that lacked either histidine or phenylalanine. Thefollowing results were obtained:It was found that hisE is 4 minutes away from pabB. The gene pheA was shown to be 17 minutes from pabB. Draw a genetic map describing the locations of all three genes.
In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?
The following two strains of E. coli are crossed with each other: Hfr pan* thi* ala* and F¯pan¯ thi¯ ala¯ It was shown that the pan marker entered last in interrupted conjugation experiments. By spreading the bacteria from these experiments on different selection media, the following results (in number of colonies) were obtained: MM + Gluc IM + Gluc + ala MM + Gluc + thi MM + Gluc + thi + ala 280 281 286 339 Give the number of each phenotypic class and justify your answer. Determine the order of the genes. What are the genetic distances between the different loci? Abbreviations: Gluc: glucose; Ala: alanine; Thi: thiamine; Pan: pantothenic acid.
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them. Sequences BAC clone 1 2 3 4 5 6 A + − − − + − B − − − + − + C − + + − − − D − − + − + − E + − − + − −
Different Hfr strains have the F factor DNA integrated into their chromosome at different locations due to Different Hfr strains have the F factor DNA integrated into their chromosome at different locations due to homologous recombination between the F factor's origin of replication and the bacterial chromosome's origin of replication. homologous recombination between an IS element within the F factor and an IS element that may be located at different chromosomal locations in different E. coli strains. random breaks that occur within the bacterial chromosome. recombination between homologous chromosomal regions of donor and recipient cells during conjugation.