Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…
A: Introduction Biological classification refers to the process of arrangements of living organisms…
Q: Explain the relationship of osmosis to enzymatic browning in potatoes?
A: Osmosis is the process of diffusion of solvent from the region of low concentrations of solute…
Q: Name three neural pathways one might expect to lead into the hypothalamus that would result in…
A: * Neural pathway is connection formed by axons from neurons to make synapses to neurons in another…
Q: What are the concepts behind osmosis and enzymatic browning in potatoes?
A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…
Q: Why do organisms with close biochemical similarities show stronger evolutionary relationships? *…
A: The answer is (c)they have the common ancestors and have the same kind of proteins.
Q: Using punnett square, determine all the possible phenotype of the offspring having parents with the…
A: Given: The blood type of the wife = Type A The blood type of the husband = Type O All possible…
Q: 6. The following statements describe evolution EXCEPT: * A. Evolution is continuous B. Evolution…
A:
Q: well-preserved mammoths have been found in ice and frozen soil in northern siberia. using…
A: When an organism dies, certain genes in its body activates that produce some hydrolysing or…
Q: Describe how the generation of functional beta cells from stem cells requires an extensive knowledge…
A: Beta cells produce insulin, a hormone that regulates the amount of glucose (a form of sugar) in the…
Q: Compare and contrast diffusion and convection. In what way dothey “alternate” in the O2 transport…
A: Introduction Diffusion is defined as the net movement of something from a higher to a lower…
Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…
A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…
Q: 1. One mL of sludge was added to a 99 mL dilution blank. Three 1/10 dilutions were then made. From…
A: CFU/ml represents the number of colony-forming units in the sample. It gives us the estimation of…
Q: Provide names of two molecular chaperons and their functions for MHC I antigen presentation pathway
A: MHC class I molecules are comprised of a polymorphic transmembrane heavy chain and a soluble protein…
Q: Discuss the consequences of diabetes - For example cardiac arrest, loss of limp and other health…
A: Diabetes or diabetes mellitus is a condition in which blood glucose levels are abnormally either due…
Q: Why are some fungi grouped under "fungi imperfecti"?
A: Deuteromycetes/Fungi imperfecti Some members are saprophytic or parasitic. A large number of…
Q: T or F. Motor signals originating in the cortex can't interfere with motor reflex response? T or F.…
A: 1) the correct answer is - TRUE but it has restrictions upto a limit. This statement is neither…
Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…
A: According to the mendelian principle, the dominant characters is expressed and the recessive…
Q: The extent to which a given gene is transcribed depends upon (A the single transcription factor…
A: Transcription is a process where DNA converted into a mRNA. It has three step initiation, elongation…
Q: Discuss different systems of biological classification briefly.
A: Introduction In this question we will discuss about the different systems of biological…
Q: Figure 1 shows a model of the electron transport chain found in the mitochondria of eukaryotes.…
A: The location of electron transport chain found in the mitochondria in eukaryotic cell.
Q: Robert Koch’s impact on Microbiology?
A: Answer
Q: ascent form of the MRNA undergoes splicing only after capping is also called hnRNA is polyadenylated…
A: A,B,C only
Q: two events in meiosis lead to genetic variation and when does each occur?
A: Meiosis is a simple biological process that occurs in the germ cells of sexually reproducing…
Q: Name the guidelines for naming of organisms?
A: Nomenclature is defined as the scientific and international system of naming any organisms.
Q: 2. Name two shuttle systems that transport NADH from cytoplasm into a mitochondrion.
A: Question no.2: The shuttle system is malate-aspartate shuttle.
Q: provide an example of a clinical scenario where a Type A patient has wild type A alleles at the ABO…
A: The ABO blood grouping is controlled by an 'i' gene. This gene has two alleles iA and iB. Both these…
Q: the level to the parts of the hain. Decomposer herbivore/primary D A food chain shows the flow of…
A: Introduction : A food chain is a linear sequence if organisms representing producer to top consumer…
Q: Describe the nature and extent of genetic variation, including genetic polymorphism, balanced…
A: There are basically three types of genetic variation. These are: Single base-pair substitution –…
Q: Explain the single molecule of single-stranded DNA ?
A: DNA is the genetic substance which contains the genetic code of living things. The terms DNA and RNA…
Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…
A: Inheritance Inheritance is the biological process from which the genetic material is transferred…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs), the…
Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…
A: Mutation The replacement of one nucleotide base with other nucleotide base is known as mutation.
Q: Food is a limiting factor for plants. A. TRUE B. FALSE
A: Living organisms can be classified into two types based on their mode of nutrition. 1. Autotrophs…
Q: A cell that is undergoing meiosis started 6 chromosomes. At the end of meiosis I: 1. How many cells…
A: Meiosis is a process in which a single cell divides twice to produce four cells with half the amount…
Q: Which of the following statements supports the idea that extinction is necessary? * A. to give way…
A: Extinction is a process in which organisms or the groups are completely wiped off from the Earth.…
Q: 1. Women who have been blind since birth almost never have breast cancer. A high level of one…
A: The pineal gland is a small endocrine gland located below the epithalamus of region of diencephalon…
Q: . Which of the following statements best explains the Theory of Natural Selection? * A. Organs…
A: Natural selection is a process of adpating the new environment to survive and to reproduce. Those…
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:
A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…
Q: Wolves recolonized a large area around Grand Teton National Park (GTNP) in the late 1990’s. Wolf…
A: A Population Growth (Gr) is calculated by subtracting the initial population from the final…
Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…
A: 1) DNA Sequence: THE BOY CUT HIS LIP AND ARE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAR ETH…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Telomerase contains DNTP molecules as a template for DNA synthesis O True O false
A: DNA( Deoxyribonucleic acid ) is two strand helical structure which serves as genetic material vin…
Q: rationale for synthesizing and rapidly degrading p53 protein
A: p53 protein synthesised byTP53 (tumour protein 53) is a 393 amino acids long protein and is known…
Q: The buzzing of the alarm clock woke Halie. She stretched, yawned, and started to salivate as she…
A: The human nervous system is a "complex network" that includes the brain, nerves, and spinal cord and…
Q: What did genera discussed the Enterococcus? Are the healthcare concerns, infections, and nosocomial…
A: DISCLAIMER "Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: List two ways you think would minimise or avoid lag phase of microbial growth
A: During lag stage, the bacteria can adjust to development conditions. It is the period where the…
Q: Explain sexual reproduction in bacteria?
A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…
Q: True or False: Based on the presentation by the State Anthropologist, the gender of a deceased child…
A: Anthropology is the study of human beings. It is the study which involves how human beings behave in…
Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…
A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…
Step by step
Solved in 2 steps