Q: How does shaking influence the growth rate of a bacterial culture? Why does it matter?
A: Microorganisms are the tiny organism that cannot be seen as such through naked eyes but requires…
Q: What happens in the cell eventually after signals are transduced?
A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…
Q: 16. What is the membrane potential when the ratio of the ion concentration values is X-1) / X.
A: The resting membrane potential, also known as the resting potential, is a voltage across the…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: What variables can affect the transformation efficiency?
A: Introduction The ability of cells to absorb extracellular DNA and express the genes that are…
Q: explain how do the CIN MSI CIMP pathways all link together in develpment of adenocarcinoma tumours…
A: Cancer is a disease in which some of the cells of the body grow uncontrollably and spread to other…
Q: If two loci are 10 cM apart, what proportion of the cells in prophase of the first meiotic division…
A: Introduction :- In both mitosis and meiosis, the prophase is the first phase of cell division. When…
Q: describe the molecular switches involved during stationary growth phase
A: The growth of bacteria is proliferation of bacterium into two daughter cells, in a process called…
Q: Demonstration of Osmosis using Potato Osmoter 1. Where was the liquid cavities of some of the…
A: Introduction: The osmosis phenomena in living plant cells is demonstrated using a potato osmometer.…
Q: purple kernel color, while the homozygous recessive genotype causes red kernel color. If corn plants…
A: Given :- Dominant allele Z and recessive allele z Dominant allele cause purple colour and the…
Q: 8. List and draw the functional groups found in carbohydrates and lipids. What chemical properties…
A: The biomolecules are the component of biological macromolecules. Carbohydrates and lipids are the…
Q: Determine if the cells in telophase II of meiosis are haploid or diploid.
A: Cell division is the process by which the parent cell gets divided into daughter cells. In…
Q: 3 in 3' 5' 5' 3'
A: * DNA replication is a process in which, double stranded DNA will be copied to produce two identical…
Q: A lotion vehicle contains 15% (v/v) of glyc- erin. How much glycerin should be used in preparing 5…
A: Volume/ volume percentage or v/v % refers to a specific amount of concentration of a particular…
Q: Amelia is a very curious young toddler. She usually explores new environments with ease, though she…
A: option A Child's environment influencing child's phenotype.
Q: Research suggests that newborns are able to discriminate their own language from a foreign language,…
A: Research shows that babies only hours old are able to differentiate between sounds from their native…
Q: When energy flows from one trophic level to the next, much of it is lost and does not make it up to…
A: In the ecosystem food chain and food web are present that gives the idea about the interaction…
Q: Macmillan Learning An extensive study of a hominid fossil dating from approximately 2 million years…
A: The fossil record of hominids is one of the finest known and most comprehensive of any animal. This…
Q: What is intercellular co2 (Ci) and is there a correlation iwth photsynthetic rate?
A: Plants create sugars and oxygen through a process called photosynthesis, which involves the usage of…
Q: Choose the statement that best describes the outcome of transfecting cells with a plasmid that…
A: A plasmid is an extra chromosomal DNA present within a cell. It is physically separated from the…
Q: What is the difference between the loss of water between a plant that is outdoors and another that…
A: The physiological process by which water is lost in the form of vapour, from the living tissues of…
Q: Describe the trends in global fish capture from 1950 to 1990 and from 1990 to 2016. Describe…
A: loss of wildlife species, and also local decreases in population density. Today, the loss of marine…
Q: Samples of three different triglycerides, A, B, and C, were tested to determine the melting point of…
A: Triglycerides are the most prevalent lipids found in living organisms, and their principal function…
Q: The Baltimore Orioles and Black-backed Orioles species complex has conflicting evidence in support…
A: The Baltimore Oriole and the Black-backed Oriole may be sister taxa, according to a recent…
Q: Explain how to prepare a rat and butterfly for dry museum preparation
A: The reasons for preserving the entire specimen in a collection might vary. Firstly, these specimens…
Q: You Answered 1. If a negatively supercoiled (ALK = -32) closed circular DNA is relaxed by one…
A: Linking number (Lk)= total number of base/basepair per helical turn in its relaxed form…
Q: 5. You are testing for unknown compounds. Evaluate the results of these tests to determine the…
A: The test given in the column are able to differentiate among different types of biomolecules such as…
Q: How do you compute maximum assimilation (Amax) and what does the value tell you about the plant?
A: The transport of chemicals from digested food into the body's cells, ie., the process of absorbing…
Q: The periplasmic space (periplasm) is found in.... Select ALL that apply & ONLY those that apply gram…
A: Introduction Bacteria are common, largely free-living organisms that frequently only have one…
Q: About how many carbon (14) beta decays occur in your body every minute?
A: Carbon 14 has a half life about 5730 years where it is reached at its 50%. 8 thousands atoms decay…
Q: Bone tissue can be described as a. dead calcified tissue b. cartilage c. the skeletal system d.…
A: We know that the bone is a hard connective tissue made from deposition of minerals on the matrix…
Q: All of the following are beneficial for a pathogenic bacterium, but, O adhesins O fructose O…
A: The bacteria are responsible for causing different disease (pathogenesis) in humans, animals and…
Q: CONCEPT APPLICATION 3. Imagine you are painting your bedroom at home. You get tired of repeatedly…
A: Introduction Skeletal muscles, often known as muscles, are parts of the vertebrate muscular system…
Q: DIRECTIONS: 1. On the left line indicate whether the statement is true (+) or false (O). 2. If the…
A: Cell division is the process by which one cell divides and produce two or more than two daughter…
Q: Being composed of molecules identical to certain ones already present in a host, the bacterial…
A: Bacterial capsule is usually made up of polysaccharides. Gram negative bacteria usually have capsule…
Q: There are several lines of evidence that suggest that chloroplasts and mitochondria were once…
A: For performing independent life, energy production is very much important. Some organisms depend on…
Q: Assume a thylakoid is somehow punctured so that the interior of the thylakoid is no longer separated…
A: Introduction Chloroplasts and cyanobacteria contain membrane-bound compartments called thylakoids.…
Q: A Moving to another question will save this response. stion 11 The lipid A component of Gram ipid A…
A: This question deals with the lipid content & its types of the gram positive and negative…
Q: Why do we compare allometric relationships with a line of unity?
A: The allometric relationship is the relationship of body characteristics like anatomy, Physiology…
Q: How do these differences affect their performance???
A: The visual organ known as a compound eye is present in arthropods, including insects and…
Q: What would be Wrong with a set point (say For body temperature) rather than a workin 2 range of…
A: Homeostasis is the potential of the body to face up to alteration with a view to preserving strong…
Q: There are two types of nutrient pools, atmospheric-hydrospheric, and sedimentary. How are they…
A: There are two types of biogeochemical cycle based on the nature of the nutrient reservoirs/pools and…
Q: 2. How does the eye perceive size, depth and relative distances? 3. With the aid of a diagram,…
A: It depends on various factors- visual angle, size constancy, perspective, Visual angle: depends on…
Q: An existing method for the treatment of spinal abnormalities is the braces method. What change can…
A: Spinal abnormalities: A change in the normal structure function or position of the spine is…
Q: why is the maintenance of homeostasis especially important during development of new umans within…
A: Maintenance of homeostatis is very important in fetuses . The placenta plays a very important role…
Q: howing statemen is/are only best answer. All three of the other statements are true. Genome…
A: Genome rearrangements can be caused by errors during Meiosis-True When a pair of homologous…
Q: Name the types of cross that would help to find the genotype of a pea plant bearing violet flowers .
A: Mendel modified pure pea plant lineages. First-generation hybrids (F1) exhibited dominant qualities…
Q: Bryan has albinism, an autosomal recessive trait, which means he is homozygous recessive for…
A: Ans: Albainism is an autosomal recessive disorder. For this disease to develop two copies of an…
Q: identical in all EVOLUTION LINK The reactions of glycolysis are organisms-prokaryotes, protists,…
A: Cellular respiration is a metabolic process that takes place inside the cell resulting in usage of…
Q: How might the molecules in the cells of Parent 1 be different from those in Parent 2 to produce the…
A: Phenotype refers to an individuals observable traits, such as height, eye colour, blood type and…
Step by step
Solved in 2 steps
- Define the term primary motor cortex?Consider three alpha-motor neurons of different sizes: small, medium and large. All three neurons receive input from the same excitatory interneuron. When the interneuron fires action potentials at low frequency, only one alpha motor neuron fires action potentials. As the action potential frequency of the interneuron increases, two alpha-motor neurons are recruited, and at maximum frequency, all three are recruited. In what order would the three alpha-motor neurons have been recruited? Large first, then medium, then small. Small first, then medium, then large. Medium first, then small, then large. Medium first, then large, then small.Motor Pathways Fill in the blanks with the terms provided. Not all terms will be used. anterior interneurons receptors posterior effectors descending lower upper skeletal muscle Motor pathways are least two motor neurons are present in the motor pathway: an upper motor neuron and a lower motor neuron. The cell body of an within the brain stem. Axons of these synapse either directly on pathways in the brain and spinal cord that control At motor neuron is housed either within the cerebral cortex or a nucleus motor neurons, or on . The cell body of a lower motor neuron is housed either within the spinal cord or within a brainstem cranial nerve nucleus. Axons of the lower motor neurons exit the CNS and horn of the project to to be innervated.
- Explain multiple-motor-unit recruitmentWhat is localization of function? Describe how localization has been demonstrated by neuropsychology and recording from neurons. Be sure you understand the principle of double dissociations.explain the simplified version of the synaptic process resulting in long-term potentiationand explain the roles of AMPA and NMDA receptors; glutamate; sodium, calcium, and magnesium ions in strengthening a synapse.
- What structural features of the primary motor cortex somatotopic map reflect the general principle of physiology that structure is a determinantand has coevolved function?Explain Local Control of Motor Neurons?Multi-cell recordings from the human motor cortex can be used to guide a robotic arm. Discuss BCI and action control: a) How the woman controls the robotic arm b) She has been paralyzed for over 20 years, but this BCI system still works for her. What does that mean? c) What kinds of information do motor neurons code?