1) Describe the key processes involved in vaccine manufacturing. 3) How were the structures of ACE 2 and spike protein solved?

Since you have asked multiple question, we will solve the first question for you. If you want any…

Answered: Describe the key processes involved in…

Science

Biology

Describe the key processes involved in vaccine manufacturing.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Related questions

Q: Why should we be against making vaccines mandatory?

A: Introduction: Vaccine is a dosage that uses a dead or attenuated version of the pathogen to produce…

Q: There is interest in producing vaccines in foods. What would be the advantages of having a vaccine…

A: Recombinant DNA technology is a technique that genetically altered vector is introduced and…

Q: Explain how labeled antibodies are used in direct and indirect tests.

A: Antibodies or immunoglobulins are the primary line of defense in the body. They recognize and bind…

Q: Explain strategies for vaccine development; include in your answerthe primary drawbacks to…

A: Vaccines are preparations of whole pathogen or antigenic parts of the pathogen, which are…

Q: Discuss which factors are involved in vaccine development and new strategies for developing…

A: Vaccine: - It is a substance which is produced by the biological preparation and which gives…

Q: What are the pros and cons of inactivated vaccines and live attenuated vaccines?

A: Inactivated vaccine contains virus , bacteria or pathogens but it is inactivated by the chemical…

Q: What are the types ofantigenic agents that mayconstitute vaccines?

A: An antigen is defined as any substance, either pathogen, cell metabolite, pollutant, pollen grains,…

Q: Which of the following is an mRNA vaccine? A. AstraZenica B. Sputnik V C. Janssen D. Covaxin

A: Introduction Vaccines:- It is a biological substance designed to protect humans from infections, it…

Q: Explain what an mRNA vaccine is and elaborate on how it differs from other types of vaccines

A: A biological preparation that is administered to a person to develop active acquired immunity…

Q: What are the advantages and disadvantages of an inactivated virus vaccine? Please make a table one…

A: Vaccines form an integral part of the community's well-being by providing the essential needed…

Q: How can the genome of a pathogen guide the vaccine designing ? How will the genome sequence…

A: The cellular mechanism in which the cell's internalization occurs and involved substances like…

Q: Describe the term serology and explain the immunologic principle behind serological tests.

A: Immune reactions to antigens result in the production of antibodies, and antibodies strongly attach…

Q: Explain how antigenic drift in the hemagglutinin influenza gene can affect vaccine effectiveness.

A: Influenza is a spherical-shaped virus particle that consists of the nucleoprotein, capsid, outer…

Q: How does vaccine revolutionize science at present time?

A: Answer: Introduction: A vaccine can prevent the infection by having less than three doses of the…

Q: What are the advantages and disadvantages of an inactivated virus vaccine?

A: Vaccines are used to prevent infectious diseases. There are vaccines available for various diseases…

Q: Discuss the key events in the production of recombinant subunit vaccine?

A: The technology used for joining different DNA molecules from different species is known as…

Q: Explain why recombinant vaccines might be safer than somevaccines produced by traditional methods

A: Vaccination is an important thing that helps to develop an immune system that ultimately protects…

Q: Why is it important to use the HTAC recommendation framework with the FDA directive towards the…

A: The SARS-CoV-2 virus causes Coronavirus Disease (COVID-19), an infectious disease. The majority of…

Q: Describe each compound of bacterial vaccines: -inactivated proteinaceous toxoids (toxoids)…

A: Several procedures are used to create vaccines. They may comprise rendered sterile or dead bacteria,…

Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…

A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…

Q: Describe the preparation of killed vaccines; live, attenuatedvaccines;subunit vaccines; recombinant…

A: Vaccination is an immunization procedure in which a person develops immunity, particularly against a…

Q: What are advantages and disadvantages of the antibody test with the coronavirus?

A: We know that The Severe Acute Respiratory Syndrome corona virus-2 (SARS-CoV-2) is responsible for…

Q: Of the following types of vaccines: attenunated live or inactivated whole agent, which is more…

A: Vaccine:It provides the immunity against one or numerous diseases. It is a substance that is used to…

Q: Explain and compare the principles behind Pfizer, Chinese, Russian Sputnik and Turkish COVID…

A: A vaccine is a biological substance that induces active acquired immunity against a specific…

Q: Explain how trangenic animals can be used in producing effective malarial vaccines?

A: Transgenic animals refer to the animals in which the foreign or altered or genes are introduced by…

Q: Which of the following assays would utilize monoclonal antibodies? MRI imaging of mice expressing…

A: Antibodies are proteins that are secreted by specialized white blood cells called B lymphocytes or B…

Q: What are steps in making an inactivated vaccine?

A: Vaccinations and Immunizations started in the 18th century, with the Smallpox Vaccination, created…

Q: Regarding inactivated vaccines and mRNA vaccines, what are the advantages of one over the other?

A: The basic principle of vaccination or immunization is based on the features of “memory” of the…

Q: Describe how vaccines prevent viral infections.

A: Genrally vaccines are attenuated germs or part of viral particles that are capable of stimulating…

Q: what is the diffrent between vaccine passport and vaccine certificate?

A: The recent occurrence of pandemic allowed the development of new means to save a person from the…

Q: Discuss the advantages of recombinant vaccines with examples

A: Vaccines were initially developed on the basis of attenuation or inactivation of pathogens. Live…

Q: Explain in detail by comparing the principles behind Pfizer, Chinese, Russian Sputnik and Turkish…

A: ANSWER: A. Principle behind Pfizer covid vaccine: Pfizer developed a coronavirus vaccine known as…

Q: Discuss in detail, how you would produce recombinant protein subunit vaccines for Influenza virus.

A: Recombinant protein vaccines, which are also known as recombinant subunit vaccines, are designed…

Q: For any virus that infects animal cells, a vaccine is available. True or False ?

Q: Why do vaccine manufacturers begin with tests on animals or cell lines before moving on to adult…

A: Vaccines are the antigens that are administered into the body.

Q: a. List the bacteria from this chapter for which general, routine vaccines are given. b. For which…

A: Immunity is the body's biological system to recognize the antigen and fight gainst them and protect…

Q: What is a recombinant DNA vaccine?Give two examples.

A: Vaccines are either attenuated or dead agents of disease which when administered into a healthy…

Q: Explain the use of chick embryo cell culture in the production of vaccines

A: The cell-based vaccine manufacturing process that uses animal cells like Madin-Darby Canine Kidney,…

Q: What are the advantages and disadvantages of a killed vaccine; a live, attenuated vaccine; a subunit…

A: There are several different types of vaccines and each type of vaccine is designed is to teach your…

Q: What is the advantage of a DNA vaccine over all the other types of vaccine ?

A: DNA vaccination has shown significant promise since its start. In terms of effectiveness, safety,…

Q: Why do vaccines take so long to make?

A: Vaccine is a product that animates an individual's immune system to create invulnerability to a…

Q: DNA vaccines contain _______ DNA that stimulates cells to makeantigens.a. human, RNA b. microbial,…

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: An enzyme-linked immunosorbent assay requires a catalytic antibody. a radioactive standard for…

A: The total protein content of a sample or a manufactured product must be understood through the…

Concept explainers

Industrial Processes

Industrial processes result in the manufacturing of products (biological products, such as enzymes, medicine) on a large scale using different methods, such as physical and chemical procedures. Few products such as pharmaceuticals, agricultural products, food items, etc., involve microbes and their enzymes. Such processes are termed industrial biological processes. Microbiology and biotechnology enable us to utilize the ability of microorganisms to produce enzymes, primary metabolites, and secondary metabolites, which in turn help to produce the desired products.

Question

1) Describe the key processes involved in vaccine manufacturing.

3) How were the structures of ACE 2 and spike protein solved?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How were the structures of ACE2 and spike protein solved
1) What are the four levels of protein folding. How do you distinguish those different levels? What can denature a protein? 2) What are detergents and why are they useful? How do they basically work? 3) What is meant by amphipathic? What is an example of this?
2.3 Manylendosomes become acidic because they have transporters in their membranes that pump H+ ions into the endosomal lumen. Which of the following statements is true? A) acidification of the endosomal lumen is critical for RNA vaccines because it increases the charge of the cationic lipids in the LNP's and thereby promotes fusion with cationic lipids in the endosomal membrane. B) RNAS are stabilized by high pH c) the pumping of H+ into the endosome likely requires energy from cellular ATP D) H+ catalyzes the conversion of pseudouridine into uridine, which is necessary before the MRNAS can be translated.
1.) What do the first four letters represent in the polypeptide sequence of SARS-CoV-2 surface glycoprotein. 2) Draw the structure of the first 4 amino acids in the polypeptide sequence of SARS CoV-2 surface glycoprotein. 3) What amino acid is encoded by the first 3-letter DNA sequence in proteins? Identify and discuss start and stop codons.
a) In the article the authors reference the canonical forces in protein folding. Describe how these forces come into play when a protein folds. Why do the authors suggest that other intermolecular interactions must be important to fully understand folding processes? https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995338/pdf/nihms-1067149.pdf
What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in Single Cell Protein.
Imagine that a mutation has been discovered in the HBA1 gene, where amino acid residue # 1 in the alpha subunit is changed from valine to lysine. The structure of these two amino acids is shown below. How would this mutation affect the mobility of HbA in the gel?a) HbA with this mutation would have the same mobility as normal HbAb) HbA with this mutation would have the same mobility as HbSc) HbA with this mutation would have a faster mobility than normal HbA O d) HbA with this mutation would have a mobility somewhere in between HbS and normal HbA
1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?
1. ) In one (1) sentence point out a key structural similarity and difference in each of the following pair of terms: a) Proline and cysteine b) Secondary and Tertiary proteins c) Uracil and thymine d) AMP and dAMP e) codon and anticodon
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
For the following proteins in the figure answer the questions below: A) Oligomerization state of the protein and molecular weight of each protomer B) Number of domains of one protomer and its potential function. C) Based on the information obtained, how many bands will you observe if you run a solution of the spike oligomer in an SDS-PAGE get and in a native gel?
6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?