d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide RNA primer 2. a 2-nucleotide Okazaki fragment
Q: Describe the different stages that process of Protein synthesis.
A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…
Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…
A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…
Q: II. Do what is asked A. 1. a. Use the codon given below to complete the following table. Assume that…
A:
Q: Describe the process of protein synthesis and localize where each step takes place. Use the…
A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…
Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…
A: All the living cells are made up of protein, which act as building blocks for every organism. These…
Q: Describe the process of protein synthesis and associated post translational modifications.
A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…
Q: Explain the process of translation, including location, processes, and molecules involved
A: Replication, transcription, and translation are the basic process in the molecular dogma of the…
Q: State the function of histones in DNA packaging.
A: Histones are highly basic proteins because they are rich in lysine and arginine residues. They are…
Q: (A) involves the formation of a peptide bond between the amino acid and tRNA
A:
Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…
A: DNA is made up of small units known as genes. These genes store all the hereditary information which…
Q: Compare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to…
A: The genetic material is transferred to the next generation through reproduction. The sequence of the…
Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…
A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…
Q: List the 4 types of RNA degradation and describe each in 1 sentence
A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…
Q: Describe nucleotide excision repair.
A: A nucleotide is defined as a structure that will consist of a sugar molecule (that can be either…
Q: Describe DNA synthesis in detail with the help of diagrams
A: DNA synthesis is DNA replication. It occurs in three stages- initiation, elongation and termination.…
Q: In details summarize the process of Translation and post translation process.
A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…
Q: a) What was the full peptide sequence before degradation? b) Paula thought she forgot to treat her…
A: Edmans degradation is a method of sequencing the amino acids in the peptide. In this first step…
Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…
A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…
Q: Discuss the genetic code, and explain how it works withdifferent types of RNA to make a protein.
A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…
Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…
A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…
Q: Caption a diagram of translation, identifying each step in the process and the role of each type of…
A: The process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum is known as…
Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.
A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…
Q: 2. Identify the following structures when given images such as the ones below: ● process of…
A: Introduction The cell is the basic structural and functional unit of life present in all living…
Q: Describe how proteins are sequenced, and explain why sequence determination is important
A: Protein sequencing is the technique to determine the amino acid sequence of a protein. Proteins are…
Q: State the purpose of DNA replication and describe the process
A: DNA (deoxyribonucleic acid) is the genetic material which plays an important role in the transfer of…
Q: (c) With the indication of sense strand, template strand, the direction of transcription, provide…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Explain the DNA translation process
A: DNA Translation: The process of translating the sequence of a messenger RNA…
Q: Using seven numbered steps, describe the process of translation.
A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…
Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: explain the feature of DNA replication and how this replication is considered accurate
A: DNA replication is the interaction by which a double stranded DNA molecule is duplicated to create…
Q: explain Nucleotide excision repair
A: Nucleotide excision repair is one of the defined methods of DNA repair. It is characterized by the…
Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…
A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…
Q: Explain the DNA repair defects .
A: DNA repair is a process in which cell identifies any defect in the DNA and correct it. Cells cannot…
Q: Write a paragraph about transcription, and include the following terms: transcription factors,…
A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…
Q: (d), Provide an overview on the replication of DNA. Provide the double-helix model of DNA.
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that form a double…
Q: n the given segment, illustrate and indicate the direction of synthesis of: a.) a 5-nucleotide RNA…
A: The replication process initiates with the unwinding of the polynucleotide strand forming a…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: Explain the genetic alterations resulting in protein synthesis defects and their relationship to…
A: In genetics, the genetic alterations is defined as the abnormalities that is caused due to the…
Q: Explain the process of Transcription and Translation. List three antibiotics and explain how these…
A: All the genetic information needed by the cell to perform its activities is encoded and stored in…
Q: In nucleic acid Differentiate: gene, genome and gene expression
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: Translation is process in which proteins are synthesized.
Q: Describe the consequences of removing or adding nucleotides.
A: Changes in nucleotide bases produce mutations, which are errors in codons. It's possible that…
Q: State the dependent and Independent Variables in the process of RNA and Protein Synthesis lab
A: Transcription is a process of RNA production from the DNA template. This process occurs within the…
Please please please. Help me answer letter d and e please. Thank you so muchhh
Step by step
Solved in 2 steps
- 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10th to 12h nucleotides with TAG. e. Replace the 3d to 5th nucleotides with ATT. Guide Questions2 Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA 5' a. What would be the first 5 bases at the 3' end of the complementary strand? а. b. What would be the first 10 bases at the 5' of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and with respect to the C-G base pair? d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide RNA primer 2. a 2-nucleotide Okazaki fragment5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
- 5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St5.If the following two primers 3'AAG5' S'CCG3' were used to facilitate the polymerase chain reaction with the DNA sequence shown below, no amplification of the gene would occur. Explain why not. K 5 S'ATTTC- 3'ТАААG --gene- -СССТАЗ GGCATS
- 1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a rate of 1 out of 107 cytosines in 24 hours. tofo NH₂ 'N cytosine deamination ----ဝိ NH spr a. If cytosine deamination occurs and DNA polymerase replicates the DNA with this altered base, what mutation would be introduced into DNA? b. Cytosine deamination is so common that DNA repair enzymes recognize uracil and replace it with cytosine. Given this information, why is it essential for DNA, the carrier of the genetic blueprint, to utilize thymine, not uracil, as a base?IV. CENTRAL DOGMA OF MOLECULAR BIOLOGY Suppose the following base sequence was found in a 30-base polymer: 3' CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5 1. What would be the first 10 bases at the 5' end of the complementary strand? Second MRNA base Your answer UUU UCU UAU UGU Phe Tyr UGC Cys UUC UAC Ser Ucc UUA UCA UAA Stop UGA Stop Leu 2. What would be the corresponding MRNA sequence of the given UUG ucG UAG Stop UGG Trp CGU His CUU CCu CAU Cuc polymer? cc CAC Pro CAA Leu CUA Cua Arg CCA CGA Gin ccG CAG CG Your answer AAU AGU Asn AGC AUU ACU Ser AUC le ACC AAC Thr ACA AGA Lys AGG AUA AAA Arg AUG ACG AAG 3. What would be the resulting amino acid sequence? (Please use the genetic code chart above.) Please separate amino acids with "dash" (e.g.phe-leu-ile). GUU GCU GAU GGU Asp GGC GAC Ala GAA GUC GCC Gly Val GUA GGA Glu GGG GCA GUG GCG GAG Your answer First MRNA base (5 end of codon) Third MRNA base (3' end of codon)5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules
- 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes. Assume there are no introns. 3' AATTAGCAGATGCATGATGCAATTACTAGCATGTAAGTA 5' 5' TПААТСGTТСТАСGTACTАCGTTAATGATCGTACATTCAT 3' Based on your knowledge of open reading frames, list the amino acid sequences of the possible protein or proteins that could be produced from this DNA sequence. You may use any codon table of your liking to complete the work. a. b. Suppose there was a sister chromatid generated from the chromosome sequence shown above. What would be its DNA sequence (provide the sequence in the space below. Be sure to identify the 5' and 3'ends)?6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA…