Construct the following: 6. 5’ dADP 7. 5’ UTP 8. G to C base pairing
Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…
A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…
Q: If the length of E.coli DNA is 1.36 mm,can you calculate the number of base pairs in ECOLI?
A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…
Q: 6.Rank order the following 10-base dsDNA sequences by "melting" temperature to single strandedness,…
A: In DNA there are four nucleotides, or bases, in DNA: adenine (A), cytosine (C), guanine (G), and…
Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…
A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…
Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…
Q: What is the purpose of the ethidum bromide that you add to the gel? Why do you need to be careful…
A: Gel electrophoresis Gel electrophoresis, it is a technique by which one can separate and analyse the…
Q: In primer designing, which of the following statements is correct? a. Primers should be 18-24 bases…
A: Primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to…
Q: If pET32a(+) is digested simultaneously with SacI and Bc1I 1. How many fragments are created? 2.…
A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…
Q: In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration…
A: Markus Noll's experiment to test the Kornberg's model of Nucleosome, also known as beads-on-string…
Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…
A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…
Q: 1. Let s and s' be two sequences, where s= GGATT and s' evolves from s by substituting the A in s by…
A: The DNA is present in a double helix sequence, which has two strands present in complementary to…
Q: For another project, you designed primers 1 and 2 with the sequences shown below. Your lab partner…
A: In molecular biology, melting temperature is the temperature at which half of the double-stranded…
Q: Which of the following factors favors the formation of the Random DNA Coil? a Enthalpy b…
A: DNA Coil: Over twisting or under twisting leads to the supercoiled state of DNA being in the form…
Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…
A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…
Q: The relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be…
A: Deoxyribonucleic acid (DNA) is the hereditary material that undergoes replication which is vital for…
Q: n the triplet code, which of the following is true? A. Each DNA base codes for three proteins.…
A: During translation, triplet codon is a set of three nucleotides, which together help to recruit the…
Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…
A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…
Q: If you repeat the okazaki experiment WITHOUT denaturing DNA, what would be the expected outcome? O…
A: The Okazaki experiment explained that the process of DNA replication is discontinuous and also…
Q: 1. A strand of dsDNA contains 22,008 bp. When relaxed and without strain, what is the linking number…
A: DNA is the genetic molecule of all eukaryotic lifeforms and most of the prokaryotes along with some…
Q: What is the Strand Length of akubisamengerjakanuts =?
A: Amino acid The building block of the protein is known as amino acid.
Q: What is the length in basepairs of these sequences? How many base substitutions are there between…
A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…
Q: In the Meselson and Stahl experiment, what part of the DNA gets labeled with 15N? Why?
A: Introduction: The main experimental proof for the semiconservative DNA replication was given by…
Q: Make a side-by-side drawing of two DNA helices: one with 10 bpper 360° turn and the other with 15 bp…
A: Answer: Introduction: DNA deoxyribose nucleic acid, it is a molecule that contains the information…
Q: In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to…
A:
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to…
A: The purines (adenine and guanine) and the pyrimidine (cytosine, thymine) are the two types of…
Q: If you ran the amplicon from the previous question (so it's about 3.7k basepairs long), on a gel,…
A: Agarose gel electrophoresis is a visualization tool that separates DNA molecules, based on their…
Q: What are the base-pairing rules?
A: The nucleotides present in the DNA are known as base pairs. There are a total of four base pairs -…
Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…
A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…
Q: if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment…
A: Aligning one or more sequences by introducing gaps is termed as gap penalty method. The introduction…
Q: For a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number…
A: In simple words, the linking number represents the number of times a curve winds around another. The…
Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…
A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…
Q: 52. Which of the following base pairings is CORRECT? Group of answer choices C-T A-C C-G A-G
A:
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: The base pairing that happens is maintained at around 0.30nm to maintain the diameter of the helix.…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: If the length of E. coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coli?
A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…
Q: A palindrome is a sequence that is read the same on both strands in the 5’—>3’ direction Question:…
A: A palindrome sequence is commonly used in biotechnology. It is the location of 6 or 7 or 8 base…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: A section of DNA composed of 4750 nucleotide pairs is found to code for 573 amino acids. Calculate…
A:
Q: Give one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA is important as it carries all the cell's information and the hereditary information. This makes…
Q: Rosalind Franklin's research contribution was essential in a. determining the nucleotide sequence…
A: DNA is double stranded helical structure.
Q: Below are 9 possible primer pairs. • Determine which primer pair is the best choice. • Explain why…
A: Primers Primers are short nucleotide sequences (18-22bp long) used to synthesise a complementary…
Q: Consider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3…
A: Here the 1,2 and 3 stand for the relative position of nucleotides . The mRNA sequence would be…
Q: What feature of the –10 sequence makes it easy to unwind?
A: Pribnow box, or -10 sequence represents the six-nucleotide-sequence TATAAT. This sequence is a…
Q: 3. We said that this 60 base-pair sequence contains an entire ORF. But if, instead, the same…
A: Introduction :- Reading frame is a sequence of bases in messenger RNA (or derived from DNA) that…
Q: Indicate the size in kilobases (kb) of DNA fragment(s) that you would expect to see if you cut a…
A: The plasmids are the extrachromosomal DNA in prokaryotic organisms. It is also found in some…
Q: Below are 9 possible primer pairs. ● Determine which primer pair is the best choice. ● Explain why…
A: Primers are used in the PCR or polymerase chain reaction. These primers anneal at a particular…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Construct the following:
6. 5’ dADP
7. 5’ UTP
8. G to C base pairing
9. A to T base pairing
10. A to U base pairing
Step by step
Solved in 4 steps with 3 images
- A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAAYou are a researcher studying a gene you think is responsible for super human strength. You call the gene HULK1. Below is the ORF of this gene from a normal strength individual (with nucleotide position indicated above). Use this sequence to answer the following questions. 1 10 20 30 39 5'- ATG TCA AAG GAC ATT CGC TGT GGG CTC AGA CTA TCA TAA -3' You design primers (6nt each) to amplify this entire sequence. Which primer set below did you use? O a. 5-TTATGA-3' and 5'-TGACAT-3' Ob.5'-TGACAT-3 and 5'-TCATAA-3' Oc 5'-ATGTCA-3' and 5'-TCATAA-3' Od. 5'-ATGTCA-3' and 5'-TTATGA-3' Oe. 5'-ATGTCA-3' and 5'-TGACAT-3'
- Below are 9 possible primer pairs. ● Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms tween 55-70°℃ are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. ● Underline or…Draw a hairpin structure like that shown in Figure 18.5 for the repeated sequence found in fragile-X syndrome (see Table 18.1).For the following sequence please design an 18 base pair forward primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAA
- 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50Consider the following coding sequence transcribed from 5' to 3'5' A T G A A G C G C T C A G T A 3' If a guanine is substituted for nucleotide 11 what type of base substitution has occurred (nucleotide level) and what would be the resulting phenotypic effect?The DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm. How many base pairs are missing from this mutant? *
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'Which of the following sequences is less favorable to find in a folded beta? Select one: a.I-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P c. E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-W