Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: Give two examples of pheromones except sex pheromones and give an example of insect aside from bees…
A: * Pheromones are chemicals secreted by insects exocrine glands and which takes an behavioral or…
Q: Gene and regulation of gene activity.
A: Gene regulation means how a cell regulate which genes are expressed among many other genes and…
Q: What is true of linked genes? Choose all that apply: pts deducted for including incorrect answers…
A: Linkage explains why some traits are typically passed down in families. Because the genes for hair…
Q: What is the difference between REGULATORY VS SUBSTRATE DEPENDENT PATHWAYs. consider WT, single…
A: There are two types of paths available. Regulatory routes and assembly or metabolic processes have…
Q: What is single molecule sequencing in real time (SMRT) ?
A: DNA sequencing is a technique for determining the order of the four nucleotide bases found in DNA:…
Q: If you are having a fever, you are in your A. zone of physiological stress B. zone of intolerance…
A: An individual has a fever assuming their internal heat level rises the ordinary scope of 98-100°F…
Q: How does cytokinesis differ in animals and plant cells?
A: The final stage in cell division in which the cytoplasm divides at the region between two newly…
Q: Consider a person without any functioning plasma cells. What effects would this condition have on…
A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…
Q: viral and human transcription is different. What molecule is used as a template strand for the viral…
A: Transcription is the process of making RNA copy of a gene sequence. It takes place in nucleus.
Q: Ultraviolet radiation can cause purine and pyrimidine bases to cross-link. True false
A: Adenine and thymine are the purines which are smaller two-ringed bases, and the pyrimidines consists…
Q: RNA molecules differ from DNA molecules in that they * a. are single stranded rather double…
A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…
Q: 4. The newly synthesized DNA strand during replication was made from the 5' to 3' direction. 5. The…
A:
Q: Discuss different systems of biological classification briefly.
A: In biology, classification is the process of arranging organisms, both living and extinct, into…
Q: 2. Label the figure of the eye shown to locate anterior cavity, posterior cavity, anterior chamber,…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: what is a plant cell
A: The cells are divided into two types based on whether or not they have a nucleus: prokaryote and…
Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…
A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…
Q: Define and describe hypertrophy of skeletal muscles. Whatconditions stimulate it?
A: Hypertrophy is described as a condition where there is an increase in the skeletal muscles. This…
Q: Name the guidelines for naming of organisms?
A: Nomenclature is defined as the scientific and international system of naming any organisms.
Q: Process: Production of glutamic acid from sugarcane molasses by corynebacterium glutamicum. Please…
A: There are about 22 amino acids. Some of the amino acids can be synthesized in our body, hence known…
Q: Compare and contrast electrical and chemical synapses.
A: When two chromosome joins they form synapsis during the cell division process and it is done between…
Q: If a population’s allele and genotype frequencies remain constant from generation to generation, (a)…
A: The Hardy-Weinberg equilibrium (panmictic equilibrium) was discovered by a group of researchers or…
Q: a. How many generations are presented in this pedigree? b. What are the most probable genotype of…
A: Pedigree It is a diagrammatical representation of the inheritance of a trait over several…
Q: Outline the events in the innate and adaptive immune responses, from when a pathogen invades to…
A: Introduction Immunity: it is the property/capability of our system to fight against the harmful…
Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…
A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…
Q: O GCATGCT O ATGCATC O TCGTACG O CTACGTA
A: Maxam-Gilbert sequencing was initially more popular, in the end, Sanger sequencing won thanks to its…
Q: a salad recipe calls for gelatin to be mixed with hot water and then canned pineapple. victoria…
A: This is due to an enzyme present in the pineapple. The enzyme name is bromelain and the details are…
Q: 1. The is the side of the epithelial cell that faces the external environment or an internal…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Monarch Monarch Species A Species B 0.5 I O Nomal Warmer Normal Warmer Climate Figure 1. The…
A: As the temperature increases, that is as the climate becomes warmer the concentration of…
Q: Why has the American medical profession risen to itspresent heights?
A: Medical profession is field which provides health care services to patient.like pharmacy, hospital,…
Q: What are the possible genotypes of the offspring if you cross a brown cow and a black cow? Black cow…
A: Here C is the dominant allele for black color and c is the recessive allele for white colour.…
Q: Charles Darwin once said, “It is not the strongest of the species that survive, nor the most…
A: This is a misquote with special reference to Charles Darwin regarding The Origin of Species in 1859.…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: What is required to form a phosphodiester bond withanother nucleotide ?
A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…
Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…
A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…
Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…
A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…
Q: Decide whether the statement is TRUE OR FALSE. Justify your answer. 1. Introns are coding regions of…
A: 1. Introns are coding regions of the DNA that becomes part of the mature mRNA after splicing.…
Q: Replication of DNA requires a primer to initiate DNA synthesis because DNA polymerase can add new…
A: DNA replication is the process by which new DNA is produced from the old DNA in the…
Q: What is the role of glial cells in the brain and other parts of the nervous system?
A: Introduction :- Glial cells, also known as neuroglia, are cells that surround and support the…
Q: My Diagnosis for Patient C Sex: Chromosomal Disorder: Justification:
A: Karyotype can be defined as a numbers ;size and shape of metaphase chromosomes.It involves the…
Q: a. What role do miscellaneous structures (where applicable) play in the organism's role for…
A: INTRODUCTION External structures are the outer covering all all the livings organisms which provides…
Q: You have now studied three different types of anatomical structures. Homologous structures show…
A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…
Q: Describe the ways in which each of the following pathogens can disarm their host’s immune system or…
A: There are a number of different ways of evading or subverting the immune response. These…
Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…
A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…
Q: Dicuss a strategie for Diabetes in the UK.
A: Blood glucose is the main source of energy and it comes from the food we eat. Diabetes is a disease…
Q: Type of Dermal Scale Cosmoid Placoid Shark Tooth Ganoid Cycloid Ctenoid Mammalian Tooth To compare…
A: Introduction cosmoid scales have hard enamel, inner layer of cosmine , and vascular bone layer.…
Q: What seems to be the function of the spindle fibers ?
A: Spindle fibers are a network of threads like filaments that are forms during the cell division…
Q: Why are some fungi grouped under "fungi imperfecti"?
A: Introduction In this question we will discuss why some fungi grouped under " fungi imperfecti".
Q: Define 'oestrus' and 'menstrual cycles.
A: There are a few key ways that pregnancy and the menstrual cycle are related. First, both involve the…
Q: What happens to sepals, petals, and stamens after fertilization? State the fate of zygote, ovule,…
A: It is well known that the embryo sac is the site of zygote formation. The embryo sac is the location…
Step by step
Solved in 2 steps
- Please state if the statements are true or false. 1. Erythrulose is a ketopentose2. The conversion of 1 mole of malate to 1 mole oxaloacetate produces 1 mole of NADHExplain the physiological mechanisms involved in blood glucose concentration regulation trying to prevent hypoglycemia which is especially dangerous for brain function.Explain why reduction in ghrelin secretion in bariatric surgery would be beneficial on glucose homeostasis?
- Please name three major sources of blood glucose. Describe how ethanol consumption causes hypoglycemia.Patient K., suffering from diabetes mellitus during the past 8 years, is in coma. The skin is dry, Kussmaul’s respiration, acetone breath is evidenced. What type of coma is it?A. KetoacidosisB. Lactic acidosisC. Hyperosmolar stateD. Hypoglycaemic comaE. Brain comaCould you please help me with this. Case Study: Patient Barry King is a 27-year-old, asthma patient with COVID-19, who now needs Mechanical ventilation due to respiratory failure related to complications from COVID. He currently weighs 75kg. His current vitals are as follows: RR-24, Breath sounds- coarse crackles in both lungs. His temperature is 102.3, BP- 152/100, HR- 115 bpm, FiO2 on 50% high flow oxygen and ABG results are:pH- 7.29, PACO2-58, PAO2-49, HCO3-23. The MD wants you to suggest ventilator orders for RT to carry out. Please write reasonable orders and defend your order (include Vt, RR, Mode, PEEP, FiO2 and other procedures or orders that would help).
- background information: You will need to burn 100 Cal extra per day for 45 days (above and over your regular routine including exercise). 15 min of mild workout, jogging or 30 min walk will burn approximately 100 calories. Question: What will be status of your blood VLDL and HDL after one year if you carried out this assignment for one year without changing your caloric intake? Explain the reason for your answer.op of Form Normal Levels of Substances in the Arterial Blood: pH 7.40 + 0.05 pCO2 (partial pressure of carbon dioxide) 40 mm Hg pO2 (partial pressure of oxygen) 90 - 100 mm Hg Hemoglobin - O2 saturation 94 - 100 % [HCO3-] 24 meq / liter Vignette #1: A 21-year-old noncompliant female with a history of type I (insulin-dependent) diabetes mellitus was found in a coma. Her blood glucose was high, as well as her urine glucose, urine ketones, and serum ketones. Her serum bicarbonate was < 12 mEq/L. Her respiration was exaggerated, and her breath had an acetone odor. Her blood pressure was 90/60 and his pulse weak and rapid (120). 1. Define noncompliant. 2. Is this person experiencing ketoacidosis or insulin shock? Explain your answer. 3. Why is the serum bicarbonate low? 4. What is the acid-base status of this individual? 5. What are the causes of the dyspnea, hypotension, and tachycardia? 6. What type of treatment does this person need?…Normal Levels of Substances in the Arterial Blood: pH 7.40 + 0.05 pCO2 (partial pressure of carbon dioxide) 40 mm Hg pO2 (partial pressure of oxygen) 90 - 100 mm Hg Hemoglobin - O2 saturation 94 - 100 % [HCO3-] 24 meq / liter Vignette #1: A 21-year-old noncompliant female with a history of type I (insulin-dependent) diabetes mellitus was found in a coma. Her blood glucose was high, as well as her urine glucose, urine ketones, and serum ketones. Her serum bicarbonate was < 12 mEq/L. Her respiration was exaggerated, and her breath had an acetone odor. Her blood pressure was 90/60 and his pulse weak and rapid (120). 4. What is the acid-base status of this individual? 5. What are the causes of the dyspnea, hypotension, and tachycardia? 6. What type of treatment does this person need?
- glucose determination explain how it happensa. What are the advantages of the glucose peroxidase method of determining blood sugar? b. The principle of spectrophotometer is is based on _____ law. c. Differenciate hyperglycemia from hypoglycemia.Following several days at high altitude the body responds to the decreased oxygen content of the atmosphere by increasing the amount of 2,3-bisphosphoglycerate it produces. Based on this information and refering to the graph below, identify the correct response from the options. Y (fraction saturation) 1.0 0.8 0.6 0.4 0.2 0.0 0 20 Oxygen Binding plot 40 60 p02 (torr) 80 100 A) Curve y=high altitude and gives a greater release of oxygen to the tissues B) Curve x = high altitude and gives a greater release of oxygen to the tissues C) Curve y=high altitude and allows more oxygen to be bound at low oxygen levels D) Curve x = high altitude and allows more oxygen to be bound at low levels
