Complete each sentence with the appropriate term or phrase. (Each box can be used more than once, and not all boxes are used.) insulators enhancers chromatin loops DNA loops CTCF TADS Connections between DNA loops proteins bound to different insulators facilitate the formation of chromatin loops called enhancers. Insulators are DNA elements that organize chromatin such that TADS have access only to specific When located between a promoter and an enhancer, an insulator can block the enhancer from activating transcription from that promoter.

Complete each sentence with the appropriate term or phrase. (Each box can be used more than once, and not all boxes are used.) insulators enhancers chromatin loops DNA loops CTCF TADS Connections between DNA loops proteins bound to different insulators facilitate the formation of chromatin loops called enhancers. Insulators are DNA elements that organize chromatin such that TADS have access only to specific When located between a promoter and an enhancer, an insulator can block the enhancer from activating transcription from that promoter.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

Arrange the levels of chromatin packing from most "open" to most condensed (chromosome, loops, nucleosomes, heterochromatin, 30-nm chromatin fiber)
Do not copy, answer fast and give type answer only Thanks a lot Which of the following is wrong for the description of protein synthesis(A) The large ribosomal subunit is constructed by proteins and ribosomal RNAs. (B) tRNA is necessary for protein synthesis.(C) DNA components are required.(D) GTP is required for the process. Alleles segregate independently of other alleles because:(A) Maternal and paternal chromosomes line up on the either side of the equator during metaphase I.(B) Crossing over in prophase I.(C) Separation of homologous chromosomes in anaphase I.(D) A and B(E) A and C Which statement is wrong for the transcription factors?(A)They can bind to the region out of the promoter.(B)They have two domains, one that binds DNA and the other that activates transcription. (C)Their functions are limited for transcription.(D)They can bind to activators. which statement about biotech is wrong? (A)DNA microarray assay can detect gene expression (B)RT-PCR cannot detect gene…
Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol I'm DONE being this guy's messenger boy Bod Moeba Sreters He can leave the (nucleus and do it himself for all I carel Arthur, the mRNA, was at the end of his strand at work.
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
me Insert Design at Painter 278 words Calibri Layout 11.5A A Aa BIU-abe X₂ X² A--A- ype here to search Font W Unique Unigriffin DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: References # M 3 How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Tell me what you want to do... Mailings Review View A-6-5- LLI Paragraph | CAG TCG TTT | ATG GGG CTT CTT TIT | GAG AAT TCA CGC I S4 | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | wwwwww O 2 A W R =-- | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | de in ACROBAT % 5 ¶ T 1 Normal AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBbCcDc AaBbCc[ AaBbCcD Aal 1 Body Text 1 List Para... 1 No Spac... 1 Table Par... Heading 1 1 Heading 2 Hea Styles Y 7 OM O 38°F JACQUI 10 L
Plssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description: -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation
The picture below depicts electron micrographs of the major levels of chromatin structure. Match each of the listed conditions with the most likely levels of chromatin structure under that condition.
nand portable. 6.5 mm micro-edge 16405U processon USE YOUR SMARTPHONE w micro-edge display design See dnclamers on product bo Revi Vide Fea Sameness and Variety (Mitosis and Meiosis) 161 Spe Example Sup SCAN Expressed using apples, DNA replication looks like this. Go look at the model of DNA on the demonstration table. We have been presenting DNA as a straight ladder, but actually it is twisted on itself like a spiral staircase. This shape is called a heliz. Observe The Chromosome Normally DNA exists as loose strands (chromatin) in the nucleus of a cell. This nuclear DNA sends a message (RNA) to the ribosomes where protein and enzymes are synthesized. When stretched out, the length of one DNA molecule in a human cell is almost 4 cm. However, the cell itself is but a tiny fraction of that size. During cell reproduction the DNA must be able to move around. So it shortens its length by tightly coiling up. In doing so, the DNA strands become wider and are visible under a microscope.…
Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol. I'm DONE being this guy's messenger boy. IMI He can leave the nucleus and do it himself for all I carel IT Arthur, the mRNA, was at the end of his strand at work.
Asap
options for all 3 are euchromatin and heterochromatin