Q: 49. The "killer" yeast phenotype is caused by A. tyramine production B. production of fusel alcohols…
A: INTRODUCTION Killer yeast They are yeast like Saccharomyces cerevisiae that can produce toxic…
Q: 8. In the scientific completion against fixism, what are the main arguments that favor evolutionism?
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: 4. a) is the energy required for this process? b) What is the experimental evidence? 5. a) Did the…
A: Introduction The movement of materials across cell membranes is referred to as cell transport.…
Q: Discuss the regulation of the tryptophan operon. How does this story change under the two…
A: Introduction: The trp operon is a collection of genes found in E. coli bacteria that code for…
Q: Discuss three differences between antigen and antibodies Explain the structure of the antibody…
A: Antigens are nonself molecules that enter into the body. Antibodies are gamma globulin and they…
Q: How does the scientific meaning of “theory” differ from the common vernacular meaning?
A: Science is derived from the latin word scientia, which means "to know". Science can't be proved by…
Q: Which of the following combinations describes the electron in the modern model of an atom? Onegative…
A: Atom It is a particle of matter that constitutes the nucleus and the orbits. The nucleus contains…
Q: explain the comparison and contrast of the immune systems between plants and animals.
A: Introduction The immune system of a body works to prevent the entry of probable…
Q: A Removing water is to osmosis A Adding water is to osmolarity B. Gated channels are to mediated…
A: Introduction Active transport is the movement of molecules across a cell membrane across a…
Q: lease evaluate the accuracy of each. (Label the statement “ACCURATE” or “INACCURATE”, and if it is…
A: There are few important points about telomeres: We know that eukaryotic chromosomes are linear ,…
Q: d) Use the graph below to complete the table: +40 0 What channel is open? What channel is closed? A…
A: Neurotransmitters can serve as chemical messengers for ion channels, neurotransmitter mainly causes…
Q: Histones are proteins that are found to be challenging to investigate and part of an enormous family…
A: Histones/ Histone protein : Histones are a family of basic proteins that associate with DNA in the…
Q: If a full bladder constitutes of urine, how long will it take you to remove all of the urine from…
A: Introduction The urinary bladder is a muscular sac located above and behind the pubic bone in the…
Q: Listen to the video about the effects of smoking in our lungs using the link below.…
A: Introduction The respiratory system is a collection of organs and tissues that assist in breathing.…
Q: What is the important function of the pentose phosphate pathway for microbial cells?
A: Introduction The pentose phosphate pathway is a metabolic process that proceeds in the reverse way…
Q: About tuberculosis
A: Introduction :- Mycobacterium tuberculosis is the bacteria that causes tuberculosis (TB). It is…
Q: Create a dichotomous key diagram for Human Pig Bird Giant panda Koala
A: Dichotomous key It is a method of determining specimens on the basis of contrasting statements that…
Q: Enumerate the different kinds of neuroglia/glial cells that support neurons. Characterize each…
A: The cells of nervous system the other than neurons which are imperable of generating and…
Q: 7.- . - Write an essay including the following points;- Discuss three differences between antigen…
A: Antigens are a toxin or other foreign substance which induces an immune response in the body,…
Q: Which of the following is NOT found in a prokaryotic genome? A. tRNA genes B. Operons C.…
A: There are 2 types of living cells present on earth, prokaryotic cells and eukaryotic cells.…
Q: Cancer usually begins in the bronchi or bronchioles. Components of cigarette smoke contribute to the…
A: Cancer is a disease that affects humans in which some body cells proliferate and divide…
Q: 12:15 Acellus Types ionary Instructions : Choose one of the following: - Directional selection:…
A: Directional selection is a negative natural selection mechanism in population genetics in which an…
Q: When selection favors homozygotes over heterozygotes it is likely that... Incorrect answer - both…
A: Natural selection is a theory that states that organisms evolved by changing their heritable traits…
Q: What is the actual meaning of Biocompatible and biodegrable for the scaffolds for biomedical…
A: Introduction A polymer is a natural or manmade substance made up of large molecules termed…
Q: Neurons supplying smooth muscle secrete histamine display receptors only on the dendrites create…
A: Introduction Neurons (also known as neurones or nerve cells) are the basic units of the brain and…
Q: Scientists today can use many investigative methods to study evolution. Which method was developed…
A: Introduction Evolution is the process of a species' characteristics changing over several…
Q: 1. What is the active substance and activity/indication (e.g. antibacterial, anti-inflammatory) of…
A: Quercetin and quercetin 4′-O-β-glucoside were the most active identified compounds. The phenolic and…
Q: Which is a disaccharide? O glucose O fructose O sucrose cellulose
A: Monosaccharides are the simplest carbohydrates; and are termed simple sugars. A disaccharide is the…
Q: How do blood proteins impact fluid movement?
A: Introduction: Blood consist of the proteins albumin and globulins are found in blood.the protein…
Q: What is cell?
A: The cell, first discovered by Robert Hooke in 1665, incorporates a long and interesting history that…
Q: Make a tabulation of the following cell organelles with their functions, one disorder related to…
A: Cell organelles These are subcellular structures that are present in the cytoplasm of the living…
Q: Provide background information on zanamivir (antiviral drug) and determine the mode of action. Be…
A: INTRODUCTION Zanamivir Zanamivir is an antiviral drug used to treat influenza caused by Influenza A…
Q: 1. What is the active substance and activity/indications (e.g. antibacterial, anti-inflammatory) of…
A: Sitaw is an herbaceous climbing plant grown for its strikingly long edible pods. Leaves are…
Q: 10. The final conformational shape of proteins and interactions with their environment and other…
A: Protein folding depends upon its outer environment. Polar amino acids present towards outside when…
Q: Assuming that the Hoosier cucumber was produced in a laboratory at Indiana University, briefly…
A: Hoosier cucumber : its belong to the family cucerbutaceae , its plants are monoecious that is…
Q: Which stage of photosynthesis makes products like ATP and NADPH? the light dependent reactions the…
A:
Q: Use physical traits seen in your animal to create a: 1 trait Punnett Square 2 trait Punnett square…
A: The Punnett square could be a table that shows the various combinations of maternal and paternal…
Q: What is the antagonist
A: Muscles Muscles are the soft tissue of the body and they help in movement and joining of bones.
Q: Case-Study Application Questions. 1 Based on the information that you gained in the case study,…
A: 1.following slides will discuss why smokers are often plagd by a cough.
Q: Which of the following is a function of a bacterial glycocalyx? Adherence to structures Protection…
A: Glycocalyx covers the bacterial cell wall. It is made inside the cell and secretes to the cell…
Q: What role does oxygen play in the electron transport chain?
A: Introduction :- An electron transport chain is a collection of protein complexes and other molecules…
Q: 2) What is your hypothesis for the possible genotypes of the female and male parent? 3) Using your…
A: A breeding experiment between two organisms that are identical hybrids for two traits is known as a…
Q: Which of the following statements describes the multifactual inheritance in genetics? A. One locus…
A: Introduction The passing on of traits from parents to their offspring is known as heredity, also…
Q: Describe how the skin and mucous membranes play an integral role in helping the body protect itself…
A: Skin surface and all the mucous membrane forms a physical barrier against antigen. It…
Q: answer this briefly ( 3-6 sentences ) Why do eating salty foods make you thirsty? Why do eating…
A: Sodium is the essential nutrient of life that performs many bodily processes such as fluid and blood…
Q: why do mangroves prefer to thrive in upper intertidal or optimal level tidal zones than lower…
A: Introduction Mangrove forest- Mangrove trees and shrubs grew in coastal intertidal zones. Mangrove…
Q: A man has six digits on each hand and foot (an autosomal dominant trait). His wife and first…
A: A condition in which an individual has more than 5 digits is known as polydactyly. Polydactyly is an…
Q: In early spring, Dr. Tom Wilson notices that there is an equal distribution of long and short…
A: Introduction :- A hypothesis is a tested statement concerning the relationship between two or more…
Q: When double strand DNA break'occurs, there are two pathways by which mammalian cells can repair this…
A: Organisms maintain the integrity of their DNA by mending most lesions and leaving only a few…
Q: gineering can help to design solutions to habitat loss for burrowing owls and other wil Make a claim…
A: Introduction Engineering design process:- A systematic, iterative problem-solving method that…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CE A TTAGCGACCAGTATATCC TACA ATC CGT CTACTTCATTO GT CTACT T CAT GTATA CTT CGT CTACT TC GT CTACTTCGT CTACTT CGT CTACT A AGT GT TTAT CCTACTTTCCC ATGTAGTA AGT CTACT A AGT AMOEBA ATTAGCG A A GTTT ATCCT A CA ATC C ATTAT C G AGTTT ATC CT ACATTC C CG T T TAT CCTACATTC C GT T TATC CTACTTT C C SPONGE EARTHWORN CT TAT C G G SHARK CTTATC TTTATC CTACTTTC GTTTATC CTACTTTC C LIZARD CTA AT KANGAROO CT A ATC DOLPHIN CTAATC CAT TTA AT TTTATCC TACT TT C CC A GGAA < 이 이이이 c5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CELL A T T AG C G A CCAGTATA T C C TAC A A T C C G TCTAC T T CATTO ATTAGCG A CCA GT TT AT C CTACA ATC C C G T CTACTT CAT11 ATTAT c G AC C A GT TT AT CCT ACATT CC c G TATACTTC GT 14 АМОЕВА SPONGE EARTHWORM C T TAT C G A C c c G TT T ATC CTACA TT C C c GT CT A CTT CGT CTTAT Cc ccc CGTTTATCCTACTTTCCCGT CT A CTTCGT CT A AT c cccc c GT T T ATC CTACT TTCCC G T CT A CTT CGT CT A AT c c ccc c G T T T AT C CTA CTT T C C CATCTACTA CTA AT ccc c c c GT T TATCCTACT TT C C CAT GT AGTA TAAT Ccc c c c GT T T AT c CTACT TT C C CATCTACTAAGT SHARK LIZARD KANGAROO GT DOLPHIN GT СAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 ATGAAGCTAC 51 TTTGCCCAGG 101 ACATCTGACA 61 TTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA 71 111 31 121 AGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAA 81 141 GGGAAAAAAT CCCCCCCCCC TTTTTTTTTTTTTTTTCCCG d. Where is the 3' UTR? Circle one. 12-72 35-72 131 109-146 41 a. Write the corresponding sequences, circle & label them in the sequence above: -35 consensus sequence: (label as -35) -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: (label as PB) 91 c. What will be the nascent polypeptide sequence translated from this mRNA? (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 (label as stop) 121-146
- Which of the following characteristics of chloroplasts and/or mitochondria make them seem more similar to bacterial cells than to eukaryotic cells?a. translocation in sensitive to chloromphenicol and erythromycinb. alternate codons are used in mitochondria genesc. introns are present in organelle genesd. DNA in organelles is not arranged in nucleosomes. Which of the following characteristics of chloroplastsand/or mitochondria make them seem more similar tobacterial cells than to eukaryotic cells?a. Translation is sensitive to chloramphenicol anderythromycin.b. Alternate codons are used in mitochondria genes.c. Introns are present in organelle genes.d. DNA in organelles is not arranged innucleosomes.The fact that we find histones in Eukarya and Archaea is most likely to indicate indicate what? O A. Histones evolved prior to Archaea and Eukarya branching off from Bacteria B. Histones evolved after Archaea and Eukarya branched off from Bacteria • C. Histones are found only in multicellular organisms • D. Histones are necessary to protect DNA from nucleases O E. Histones are a product of convergent evolution
- 1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 ATGAAGCTAC 51 TTTGCCCAGG 101 61 TTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA 111 71 31 121 AGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAA d. Where is the 3' UTR? Circle one. 12-72 35-72 81 131 109-146 41 ACATCTGACA GGGAAAAAAT CCCCCCCCCC TTTTTTTTTT TTTTTTCCCG 91 a. Write the corresponding sequences, circle & label them in the sequence above: -35 consensus sequence: (label as -35) -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA:_ Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA:_ (label as PB) 141 (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 c. What will be the nascent polypeptide sequence translated from this mRNA? 121-146 (label as stop)ANCESTOR CELL AT TA GCG A C C A G T A T A T C C T A CAA T C C G T C T A CT T CA T TO AlTIA G| cl Gl Al cl cl Al G I T TAT CCT A CAATCCCGTCTACTTCAT 11 АМОЕВА A IIAI cl G A cl cl Al G T I I AT cl cl T Al cl AlTI clcl cl Gl T TACTTC I 13 SPONGE EARTHWORM CTTA T C G A cl cl cl Gl TT I A T cl cl I A cl AT Iccl clGIcIA CIIC T 15 SHARK CT TA TC C C C C C G T TTATC C T A CTTTCCC G TCTACTTC I 18 CTAATC C C c C C G T T TATCCTACTTTCCCG| T CTACTTC 19 LIZARD CIAAIC cl cl cl cl cl G T I I AT cl cl T A clIIIcl cl cl ICIA CT T| 19 KANGAROO DOLPHIN CTAATC C C C C C G T T TAT CC TA CTTT CC C T TA T T 19 TA AT C C C c C C G T TT ATC C T ACTTTC CC TA CT T| 19 CAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is shared by all the organisms on the outside. Inside each box, write the organisms that have only that set of traits.PART IV. MOLECULAR BIOLOGY (DNA/PROTEIN SEQUENCES) Scientists use DNA/protein sequences to figure out which organisms are most closely related to each other. Cytochrome c is a protein found in mitochondria used in the study of evolutionary relationships among organisms. DIRECTIONS: Study the table below that shows the amino acid sequences for cytochrome c in several organisms. Compare the human amino acid sequence to the other species. Then, for each non-human organism, circde any amino acids different from the human amino acid sequence. Record how many differences you found in the table and answer the questions that follow. Organism Biochemical Data Ala Pro Tyr Ser lle Asp Lys Glu Ala Lys Val Asp Gly Glu Lys Glu Lys Human Glu Ala Glu Phe Ser Asp Thr Asp Lys Ser Chicken Pig Glu Ala Thr Glu Lys Glu Lys Ala Pro Phe Ser Asp Thr Asp| Thr Pro Phe Ser Asp Thr Phe Ser Asp Thr Glu Horse Glu Ala Pro Phe Thr Dog Whale Gly Ala Lys Glu Lys Gly Ala Lys Lys Glu Ala Glu Thr Glu Ala Val Thr Monkey Glu…
- . While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.*00 g organisms use nformation from e is nearly identical ants, and animals. These two enzymes are found in nearly all living organisms. When you studied the cytoskeleton, you learned about the proteins actin and tubulin. Actin and tubulin are found in all eukaryotes. VAn actin gene in humans is 92% identical to the homologous actin gene in mice. An actin gene in humans is 80% identical to the homologous gene in yeast. What does this say about how long ago these organisms had a common ancestor? rom common lting from common One example of s that determine es determine which which become the Key growth of the front ons in the Hox genes sm's structure. Some nost all multicellular Hox genes must have ncestors. ection at research of the ural selection? to observe natural selection ge happens very slowly. Pa V 9.FA MAT- SP BIO-2 SP BIO-2 tal Learnin Match the part of a cell from the left column to the best description on the right. Golgi Apparatus A. all eukaryotic cells have one of these B. site of photosynthesis C. gives cells shape and involved in cell movement D. site of cellular respiration Chloroplast Rough Endoplasmic Reticulum (ER) Mitochondria Nucleus Plasma Membrane _Cytoskeleton Cell Wall E. made of phospholipids and surrounds cell F. synthesizes new proteins G. outside of plasma membrane H. involved in exocytosis