Chymotrypsin cleaves the N-terminus side of Phe, Tyr, and Trp. O True O False
Q: Light exercise allows more rapid removal of lactic acid caused by intense exercise True O False
A: The ability to generate hard work comes from the breakdown of ATP, or adenosine triphosphate. Our bo...
Q: The proofreading of DNA is essential for faithful replication. True False
A: Introduction - DNA polymerase 1 and 2 are known to excise erroneous nucleotides before the introduc...
Q: Which two amino acids may be encoded in genes by stop codons? O A. L-Ornithine and L-Citrulline O B....
A: Amino acids are the building blocks of protein. They contain amino group and carboxyl group along wi...
Q: What were some of the most interesting learnings in biochemistry?
A: Biochemistry, often known as biological chemistry, is the study of chemical processes inside and rel...
Q: Which of the following about suicide substrates is incorrect? O They form a covalent bond with the a...
A: Suicide substrate are substrate molecule which remain inert until it binds to enzymes active site. O...
Q: In cation exchange chromatography, positively charged proteins exit the column first. In anion excha...
A: Chromatography is a technique in which components of a mixture are separated. It consist of a mobile...
Q: A two-step pathway that is activated by the secretion of glucagon and adrenaline
A: Glucagon and adrenalin, both induce an increase in hepatic glucose levels. However the mechanism of ...
Q: 1. Which of these activities occur in ER? You can select more than one. Transcription Translation pr...
A:
Q: 1. Which of the following proteins are coagulated by heat? A. Albumin B. Globulin C. Glutelins D...
A: Proteins are the macromolecules made up of amino acids. They are made up of Carbon, Hydrogen, nitrog...
Q: What mechanism of antibiotic resistance does the NDM gene code for?
A: Antibiotic Resistance is the phenomenon by which any bacteria can survive in the presence of Antibio...
Q: Arabidopsis Mammal S.c. S. p. RabF1 RabF1, ARA6, associated with putative endosomal compartments. -R...
A: Rab proteins are responsible for intracellular trafficking of various substances between different m...
Q: Why is there such a large range of ∆G for the second step of glycolysis?
A: Glycolysis is the sequence of reactions that are used to break down glucose into two three-carbon co...
Q: why chromotography isn't a good fit to detemine mitochondrial RNA polymerase
A: Mitochondrial RNA polymerase (mtRNAP) is vital for biogenesis of mitochondria as well as mitochondri...
Q: A ligand binds two different receptors with a Kd value of 10−7 M for receptor 1 and a Kd value of 10...
A: Introduction: A protein binds a ligand through a specific reversible reaction. The ligand-binding ca...
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it produc...
A: Acrolein test is commonly used to detect the presence of lipids in a sample. The sample is treated w...
Q: Please help me in detail. for molecular Mechanism of ATP versus GTP selectivity of adenylate kinase,...
A: Enzyme substrate selectivity is required for precise control of metabolic pathways. In cases where c...
Q: Which of the following does NOT contain 1,4 glycosidic linkage? వార్ CH,OH CH,OH CH;OH CHOH о он HO ...
A: Glycosidic linkage refers to C-O-C linkage between two carbon atoms of different monosaccharide unit...
Q: 1.Fructose and galactose can be distinguished by which of the following reagents? * a.Fehling’s reag...
A: Both glucose and fructose are monosaccharides. Glucose is aldohexose and fructose is a keto hexose. ...
Q: Calcitonin reduces Ca+ from the blood
A:
Q: 1. The graph given represents a size-exclusion chromatogram after the refolding of the hemoglobin te...
A: Chromatography is a technique of protein purification in which protein can be separated based on its...
Q: Which of the following differentiates chitin with cellulose? Chitin has the alpha (1-4) glycosidic l...
A: Polysaccharides are carbohydrates composed of more than 100 monomeric units. Polysaccharides are cla...
Q: Choose the plot that best reflects the activity of an enzyme inhibited irreversibly. 100% A B C D ti...
A: Enzyme inhibitors are the substances that bind to enzyme either at active site or allosteric site so...
Q: INTRUCTIONS: - Do not copy here in BARTLEBY or GOOGLE - PLEASE ANSWER PROPERLY Failed to follow inst...
A: The most prevalent lipids in nature are fats and oils. They give life energy, protect bodily organs,...
Q: The enzymatic activity of an enzyme with Kg = 2 mM that converts substrate S into product P is measu...
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that o...
Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and effi...
A: DNA replication is a complex process of producing copies of the entire chromosome using the templa...
Q: List some important types of molecular interactions involved in recognition and binding of polysacch...
A: Polysaccharides, also called as glycan are the abundant carbohydrates found in food. They are compos...
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase ...
A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus...
Q: How is the beta-sheet different from the alpha-helix?
A: The structure of proteins have different levels of organization such as primary, secondary, tertiary...
Q: The monosaccharide shown below is the anomer. CH2OH CH2OH Но OH alpha- beta- O D- OL-
A: An anomer can be defined as the isomeric forms of monosaccharides that differ onlyin their configura...
Q: What is it about the structure of cellulose and starch would cause these two sugars to produce lower...
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the ...
Q: Which of the following pairs are correct? Ribulose:Aldotriose; Tagatose:Aldopentose Ribose:Ketohexos...
A: The answer is the last option Mannose is an Aldohexose and Psicose is a ketohexose is correct. Mann...
Q: Agarose Gel Electrphoresis of Serum Proteins Results 1 2 3 4 56 7 8 9 10 11 12 Wells Wells Chicken s...
A: Serum proteins are mainly Albumin and different classes (alpha, beta , gamma) of globulins. Albumins...
Q: Which enzyme would have the greatest catalytic efficiency? a) Km 20 nM; kcat 50 s-1 b) Km 0.04 uM; ...
A: [S] is Substrate concentration V is velocity of reaction Kcat - Catalytic constant(Turnover number...
Q: Between glucose and fructose, which monosaccharide is metabolized faster? Why?
A: Both glucose and fructose are monosaccharides. Both undergo oxidation and produce two molecules of p...
Q: What is the difference between obligate and non-obligate chain terminating nucleotides? How were sof...
A: Chain terminating nucleotides are nucleotides which terminates the RNA synthesis, that is also call...
Q: Give me a good introduction for the use of citric acid as antioxidant to preserve the flavor of food...
A: Citric acid is one of the most common food additives and flavor enhancers. It can be found naturally...
Q: Filtration
A: "Answering filtration as asked" In laboratories, filtration is an intriguing sterilization approach....
Q: Amylopectin and cellulose are being compared. Which of the following choices explains the similarity...
A: Polysaccharides, also known as polycarbohydrates, are the most abundant carbohydrates found in food....
Q: Can we determine the type of monosaccharide with the Molisch experiment?
A: Carbohydrates have the chemical formula Cn(H2O)n and are organic molecules. This formula, however, d...
Q: II. The most highly sensitive test in viral hepatitis is y-Glutamyl transpeptidase (Y-GT) increased ...
A: Gamma-glutamyl transpeptidase is an enzyme present in the body. GGT test is the diagnostic test that...
Q: . The buffer that is adjusted to control acid-base balanceis ________.a. plasma proteinb. hemoglobin...
A: Carbon dioxide is produced in huge quantities in tissues with a high metabolic rate. Carbon dioxide ...
Q: These carbohydrates are not easily digested by humans, EXCEPT: Cellulose Amylopectin O Cellobiose Ch...
A: The dietary carbohydrates must first be digested to glucose, fructose or galactose before bein absor...
Q: Rank the degree of sweetness of the sugar solutions. 1 – most sweet; 10 – least sweet
A: Sugar cane or sugar beets are used to make refined sugar, which is extracted from the plants after t...
Q: What is the meaning of proofreading activity ? O A. The polymerase checks for the correct incorporat...
A: DNA means deoxyribo nucleic acids. DNA act as genetic material in most organisms present on earth. T...
Q: What are the factors to be considered in designing an enzyme kinetics experiment??
A: Enzymes are biological catalysts that increase the rates of reactions in cell but do not themselves ...
Q: Which of the following statements concerning carbohydrates is correct? O They can exist in left-hand...
A: Carbohydrates are very important biochemical molecules of a human body but certainly not the most ab...
Q: Which of the following is true concerning nonreducing sugars? Question 22 options: Formed thro...
A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. The carbohydrates ...
Q: Given the chromatogram below in a normal phase, which samples would be the least polar? • Samples B ...
A: Chromatography is a technique, used to separate related compounds from a mixture. It is used for the...
Q: Which of the following statements regarding competitive enzyme inhibition is correct? O The substrat...
A: Enzyme inhibitors are the substances that bind to enzyme either at active site or allosteric site an...
Q: Create a flowchart of Amino Acids and classify them depending on the polarity of its R group
A: Introduction: Amino acids are molecules that contain an amine group, a carboxylic acid group, and a ...
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Question 16 Concerning SDS-PAGE: |A The gel is a copolymer of agarose and bis- agarose. BA magnetic field drives the migration of the proteins within the gel. C Is usually performed in presence of a molecular weight marker composed of a mixture of polynucleotides of known molecular weight. D The gel behaves like a molecular sieve. E In this type of electrophoresis the proteins migrate from the positive (+) to the neg- ative (-) electrode.Question 1 Amyloid Precursor Protein (APP) is actually thought to be a natural neuroprotective agent induced by neuronal stress or injury. O True O False Question 2 Which of the following is not a property of serine protease? A globular protein with high molecular weight ● It is initially synthesized as a zymogen It has uniquely activated tyrosine residue at the active site Cleaves polypeptide at a specific amino acid residue Question 3 RTK is activated by cyclic AMP. O True FalseQuestion 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly G
- Question 15 gal(a1-6)gal(a1-6)glc(a1-2B)fru. Which of the complete IUPAC of this tetrasaccharide? a-D-galactopyranosyl-(1–6)- a-D-galactopyranosyl-(1-6)- a-D-glucopyranosyl-(1-2)-B-fructofuranose a-D-galactopyranosyl-(1-6)- a-D-galactopyranosyl-(1-6)- a-D-glucopyranosyl-(1-2)-B-fructofuranoside O a-D-galactopyranosyl-(1-6)-B-D-galactopyranosyl-(1–6)- a-D-glucopyranosyl-(1-2)-8-fructofuranoside O a-D-galactopyranosyl-(1-6)-B-D-galactopyranosyl-(1–6)- a-D-glucopyranosyl-(1-2)-8-fructofuranoseQuestion 18 The tRNA having a cloverleaf structure suggests the following features EXCEPT some segments can hydrogen bond because of complementary A bases it is a single stranded linear structure with protein coding B sequences © it has segments that can form stem-loops modified bases are usually found at the loops in a stem-loop D segmentQuestion 4. Imagine the main chain of a protein bends back on itself so that two amino acid residues R1 and R2 come close to each other. In the table below are four possibilities for what R1 and R2 might be. In each case, decide whether a specific interaction could form between the residues. If a specific interaction could form, give the name of the interaction. R₁ cysteine tyrosine threonine arginine R₂ cysteine phenylalanine glutamine aspartate specific interaction? OO yes O yes O no no OO O yes no yes no name of specific interaction 0 П 0 0
- Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)QUESTION A test protein contains the following 4 ratios of its amino acid content (mg/g) vs the amino acid content in the adult reference pattern (mg/g): histidine 0.80, isoleucine 0.62, methionine + cysteine 0.50, tryptophan 0.60. What is the test protein's amino acid score (AAS)? O 0.80 O 0.62 O 0.60 O 0.50 O Cannot calculate given this information QUESTION Based on question 25, what is/are the limiting amino acid(s) in this test protein? O Histidine O Isoleucine O Methionine + cysteine O Tryptophan O Cannot calculate given this information QUESTION The test protein referred to in question 25 and 26 has a digestibility of 90%. What is the protein digestibility-corrected amino acid score (PDCAAS)? O 0.80 O 0.56 O 0.50 O 0.45 O Cannot calculate given this informationQUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E → citrulline ARG-F ARG-H ornithine argininosuccinate arginine Mutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown. Growth is shown by (+) and no growth is shown by (o). Supplements ornithine mutant nothing citrulline arginino- succinate arginine strain What can you conclude from these data? O Strain a has only one mutation and it is in ARG-E. O Strain b has only one mutation and it is in ARG-H. O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E. O Strain b has mutations in ARG-E, ARG-F, and ARG-H. + +
- QUESTION 12 The leucine zipper domain of transcription factors is not involved in DNA recognition but rather in facilitating dimerization. Given the chemical properties of the amino acid leucine, dimerization of transcription factors via this domain by (select the correct option). Facilitating hydrogen bonding with the aqueous environment. Chelation of bivalent ions such as Zn2+. Formation of coiled-coils through hydrophobic non-covalent interactions between evenly spaced Leu residues in alpha-helical domains. Physically connecting the two transcription factor subunits through unstructured loops.Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA that could increase solubility without drastically reducing duplex stability. PNA R1 HN но. Base Base o=P-O NH Base Base 8 o=P-O- NH 8. Base Base НО NHQuestion one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -